m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00358)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PIK3R2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | LX2 cell line | Homo sapiens |
|
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
|
GSE207909 | |
| Regulation |
![]() ![]() |
logFC: 1.59E+00 p-value: 3.69E-27 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between PIK3R2 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 2.42E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 promotes the progression of retinoblastoma through Phosphatidylinositol 3-kinase regulatory subunit beta (PI3K-p85/PIK3R2)/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Retinoblastoma | ICD-11: 2D02.2 | ||
| Responsed Drug | Rapamycin | Approved | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| mTOR signaling pathway | hsa04150 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | WERI-Rb-1 | Retinoblastoma | Homo sapiens | CVCL_1792 |
| Y-79 | Retinoblastoma | Homo sapiens | CVCL_1893 | |
| In-vivo Model | To establish a subcutaneous tumour model in nude mice, 2 × 107 Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 106 per mouse). | |||
Retina cancer [ICD-11: 2D02]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 promotes the progression of retinoblastoma through Phosphatidylinositol 3-kinase regulatory subunit beta (PI3K-p85/PIK3R2)/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment. | |||
| Responsed Disease | Retinoblastoma [ICD-11: 2D02.2] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Rapamycin | Approved | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| mTOR signaling pathway | hsa04150 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | WERI-Rb-1 | Retinoblastoma | Homo sapiens | CVCL_1792 |
| Y-79 | Retinoblastoma | Homo sapiens | CVCL_1893 | |
| In-vivo Model | To establish a subcutaneous tumour model in nude mice, 2 × 107 Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 106 per mouse). | |||
Rapamycin
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | METTL3 promotes the progression of retinoblastoma through Phosphatidylinositol 3-kinase regulatory subunit beta (PI3K-p85/PIK3R2)/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment. | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Retinoblastoma | ICD-11: 2D02.2 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| mTOR signaling pathway | hsa04150 | |||
| Apoptosis | hsa04210 | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | WERI-Rb-1 | Retinoblastoma | Homo sapiens | CVCL_1792 |
| Y-79 | Retinoblastoma | Homo sapiens | CVCL_1893 | |
| In-vivo Model | To establish a subcutaneous tumour model in nude mice, 2 × 107 Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 106 per mouse). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00358)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M1ASITE000067 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169534-18169535:+ | [2] | |
| Sequence | CTCTCCATGTTGGGGGTCCTAACTCCCCCACCCCATATCTA | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m1A-MAP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000426902.5; ENST00000222254.13 | ||
| External Link | RMBase: m1A_site_543 | ||
5-methylcytidine (m5C)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE001848 | Click to Show/Hide the Full List | ||
| mod site | chr19:18161046-18161047:+ | [3] | |
| Sequence | TGGACGTGTGCCCCCCTGCACCCGCAGACTGGTCCCTGAGC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000426902.5; ENST00000617642.1; ENST00000474310.1; ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m5C_site_23588 | ||
| mod ID: M5CSITE001849 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169403-18169404:+ | [3] | |
| Sequence | ATCCAGGGGTCCTCATTTCTCCGGCTCTGGCTCTTGTTTGG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m5C-RIP-seq; Bisulfite-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1 | ||
| External Link | RMBase: m5C_site_23590 | ||
| mod ID: M5CSITE001850 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169404-18169405:+ | [3] | |
| Sequence | TCCAGGGGTCCTCATTTCTCCGGCTCTGGCTCTTGTTTGGG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m5C-RIP-seq; Bisulfite-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m5C_site_23591 | ||
| mod ID: M5CSITE001851 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169978-18169979:+ | [3] | |
| Sequence | AGCACTTTGGGAGGCCAAGACGGGCGGATCTTTTGAGGTCG | ||
| Cell/Tissue List | heart; HEK293T; lung; HeLa; T24 | ||
| Seq Type List | Bisulfite-seq; m5C-RIP-seq | ||
| Transcript ID List | rmsk_4958106; ENST00000593731.1; ENST00000222254.13; ENST00000426902.5 | ||
| External Link | RMBase: m5C_site_23592 | ||
N6-methyladenosine (m6A)
| In total 51 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE040514 | Click to Show/Hide the Full List | ||
| mod site | chr19:18153174-18153175:+ | [4] | |
| Sequence | GGCGGGCCAGGCCGCTCGGAACCGTGGCGGCGGCGGAGGCG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; GSC-11 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428346 | ||
| mod ID: M6ASITE040515 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155606-18155607:+ | [5] | |
| Sequence | GCCTCACCTGCTGATGGAGGACTCAATGGCCCAGTGACCTG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; MT4; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TREX; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428347 | ||
| mod ID: M6ASITE040516 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155670-18155671:+ | [5] | |
| Sequence | CACCAGCTGACGAATGGTGGACCCAGTGACGAGTGGCCCTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MT4; MM6; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000426902.5; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428348 | ||
| mod ID: M6ASITE040517 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155748-18155749:+ | [6] | |
| Sequence | GGCCCCTGTGGTCGCCTGTGACTGCTGGAGATAGAGGTCCC | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | A549; AML | ||
| Seq Type List | m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000426902.5; ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428349 | ||
| mod ID: M6ASITE040519 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155783-18155784:+ | [7] | |
| Sequence | GGTCCCAGCACCCCAAGCCAACCCAGCGGACCCTCCCAGCC | ||
| Motif Score | 2.153267857 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428350 | ||
| mod ID: M6ASITE040520 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155792-18155793:+ | [5] | |
| Sequence | ACCCCAAGCCAACCCAGCGGACCCTCCCAGCCCTGCTTCAA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1B; H1A; hNPCs; hESCs; GM12878; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428351 | ||
| mod ID: M6ASITE040521 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155857-18155858:+ | [5] | |
| Sequence | GCAGCCACCTAACCATCCAGACCCCACCCCACTCACGCGGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428352 | ||
| mod ID: M6ASITE040522 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155943-18155944:+ | [5] | |
| Sequence | CCGCCGGGAGCGGCCGGAGGACCTGGAGCTGCTGCCCGGCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000617130.4; ENST00000617642.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428353 | ||
| mod ID: M6ASITE040523 | Click to Show/Hide the Full List | ||
| mod site | chr19:18160559-18160560:+ | [5] | |
| Sequence | TTGTGGAGGCCATTGAAAGGACAGGTAAGTTCCAGCCTGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; peripheral-blood; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000617642.1; ENST00000617130.4; ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428354 | ||
| mod ID: M6ASITE040524 | Click to Show/Hide the Full List | ||
| mod site | chr19:18160924-18160925:+ | [5] | |
| Sequence | CCCTTCACCCCCAGGGCTGGACAGCGAATCTCACTACCGCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; peripheral-blood; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000474310.1; ENST00000426902.5; ENST00000617642.1; ENST00000593731.1; ENST00000617130.4; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428355 | ||
| mod ID: M6ASITE040525 | Click to Show/Hide the Full List | ||
| mod site | chr19:18161083-18161084:+ | [5] | |
| Sequence | GAGCGACGTGGATCAGTGGGACACGGCAGCCCTGGCTGACG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000617642.1; ENST00000474310.1; ENST00000426902.5; ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428356 | ||
| mod ID: M6ASITE040526 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162019-18162020:+ | [5] | |
| Sequence | GTGGAGAAGCTGCTTCAGGAACACTTGGAAGAGCAGGAGGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000593731.1; ENST00000617130.4; ENST00000617642.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428357 | ||
| mod ID: M6ASITE040527 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162214-18162215:+ | [5] | |
| Sequence | CCCCCAGCGCTGCCGCCTAAACCCCCCAAGGCAAAGCCGGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000593731.1; ENST00000600533.2; ENST00000222254.13; ENST00000426902.5; ENST00000617642.1 | ||
| External Link | RMBase: m6A_site_428358 | ||
| mod ID: M6ASITE040528 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162300-18162301:+ | [5] | |
| Sequence | TGCTGAGTGGTACTGGGGGGACATTTCAAGGTAGGTTGCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000617642.1; ENST00000617130.4; ENST00000426902.5; ENST00000593731.1; ENST00000600533.2 | ||
| External Link | RMBase: m6A_site_428359 | ||
| mod ID: M6ASITE040530 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162425-18162426:+ | [5] | |
| Sequence | AGGGAGGAGGTGAACGAGAAACTCCGGGACACTCCCGATGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000593731.1; ENST00000617642.1; ENST00000222254.13; ENST00000600533.2; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428360 | ||
| mod ID: M6ASITE040531 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162433-18162434:+ | [5] | |
| Sequence | GGTGAACGAGAAACTCCGGGACACTCCCGATGGCACCTTCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13; ENST00000426902.5; ENST00000617642.1; ENST00000617130.4; ENST00000600533.2 | ||
| External Link | RMBase: m6A_site_428361 | ||
| mod ID: M6ASITE040532 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162554-18162555:+ | [5] | |
| Sequence | GGGGGTCACAGGTCACAGAGACCGGGAGTTCAGAGGGGATA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000593731.1; ENST00000600533.2; ENST00000426902.5; ENST00000617642.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428362 | ||
| mod ID: M6ASITE040533 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162577-18162578:+ | [5] | |
| Sequence | GGGAGTTCAGAGGGGATAGAACATGTGCGGTTTCAAGAATG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000600533.2; ENST00000222254.13; ENST00000593731.1; ENST00000617642.1; ENST00000617130.4; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428363 | ||
| mod ID: M6ASITE040534 | Click to Show/Hide the Full List | ||
| mod site | chr19:18162977-18162978:+ | [5] | |
| Sequence | CTCCCCCAGGAAAGGCGGGAACAATAAGCTGATCAAGGTCT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1; ENST00000617642.1; ENST00000617130.4 | ||
| External Link | RMBase: m6A_site_428364 | ||
| mod ID: M6ASITE040535 | Click to Show/Hide the Full List | ||
| mod site | chr19:18163055-18163056:+ | [5] | |
| Sequence | CACCTTCTGCTCCGTTGTGGACCTCATCAATCACTACCGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000617130.4; ENST00000617642.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428365 | ||
| mod ID: M6ASITE040536 | Click to Show/Hide the Full List | ||
| mod site | chr19:18163109-18163110:+ | [5] | |
| Sequence | CCAGTACAATGCCAAGCTGGACACACGGCTCCTCTACCCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000617642.1; ENST00000222254.13; ENST00000593731.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428366 | ||
| mod ID: M6ASITE040537 | Click to Show/Hide the Full List | ||
| mod site | chr19:18163281-18163282:+ | [5] | |
| Sequence | GGACCAGATTGTCAAGGAGGACAGCGTGGAGGCAGTGGGCG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; brain; kidney; Huh7 | ||
| Seq Type List | m6A-seq; m6A-REF-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000222254.13; ENST00000593731.1; ENST00000426902.5; ENST00000617642.1 | ||
| External Link | RMBase: m6A_site_428367 | ||
| mod ID: M6ASITE040538 | Click to Show/Hide the Full List | ||
| mod site | chr19:18163335-18163336:+ | [5] | |
| Sequence | CTATCACCAGCAGTACCAGGACAAGAGCCGCGAGTATGACC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000617642.1; ENST00000222254.13; ENST00000426902.5; ENST00000617130.4 | ||
| External Link | RMBase: m6A_site_428368 | ||
| mod ID: M6ASITE040539 | Click to Show/Hide the Full List | ||
| mod site | chr19:18163379-18163380:+ | [5] | |
| Sequence | TTTATGAAGAGTACACACGGACCTCCCAGGTACTCCAGGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000617130.4; ENST00000593731.1; ENST00000617642.1; ENST00000426902.5; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428369 | ||
| mod ID: M6ASITE040541 | Click to Show/Hide the Full List | ||
| mod site | chr19:18166201-18166202:+ | [5] | |
| Sequence | CAATTGAGGCCTTCAATGAGACTATCAAGATCTTTGAAGAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; MM6; Huh7; Jurkat; peripheral-blood; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000426902.5; ENST00000617130.4 | ||
| External Link | RMBase: m6A_site_428370 | ||
| mod ID: M6ASITE040542 | Click to Show/Hide the Full List | ||
| mod site | chr19:18166231-18166232:+ | [5] | |
| Sequence | TCTTTGAAGAGCAGGGCCAGACTCAAGAGAAATGCAGCAAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1; ENST00000617130.4 | ||
| External Link | RMBase: m6A_site_428371 | ||
| mod ID: M6ASITE040543 | Click to Show/Hide the Full List | ||
| mod site | chr19:18167140-18167141:+ | [5] | |
| Sequence | CTCCCACAGGATCCTGCTGAACTCCGAGCGGCTCAAGTCCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; BGC823; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000617130.4; ENST00000464016.3; ENST00000222254.13; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428372 | ||
| mod ID: M6ASITE040544 | Click to Show/Hide the Full List | ||
| mod site | chr19:18167224-18167225:+ | [5] | |
| Sequence | GCTGCGGGCCCAGGCCTCGGACAACAGAGAGATCGACAAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; BGC823; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000464016.3; ENST00000426902.5; ENST00000617130.4; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428373 | ||
| mod ID: M6ASITE040545 | Click to Show/Hide the Full List | ||
| mod site | chr19:18167251-18167252:+ | [5] | |
| Sequence | AGAGATCGACAAGCGCATGAACAGCCTCAAGCCGGACCTCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; BGC823; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000617130.4; ENST00000222254.13; ENST00000464016.3; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428374 | ||
| mod ID: M6ASITE040546 | Click to Show/Hide the Full List | ||
| mod site | chr19:18167266-18167267:+ | [5] | |
| Sequence | CATGAACAGCCTCAAGCCGGACCTCATGCAGCTGCGCAAGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; BGC823; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000464016.3; ENST00000426902.5; ENST00000593731.1; ENST00000617130.4 | ||
| External Link | RMBase: m6A_site_428375 | ||
| mod ID: M6ASITE040547 | Click to Show/Hide the Full List | ||
| mod site | chr19:18167293-18167294:+ | [5] | |
| Sequence | GCAGCTGCGCAAGATCCGAGACCAGTACCTCGTGTAAGTGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; hNPCs; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000617130.4; ENST00000593731.1; ENST00000464016.3 | ||
| External Link | RMBase: m6A_site_428376 | ||
| mod ID: M6ASITE040548 | Click to Show/Hide the Full List | ||
| mod site | chr19:18168538-18168539:+ | [5] | |
| Sequence | GGCTGGGGATTAAAAATGAGACTGAGGAGTGAGTGACCGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; hNPCs; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000459743.2; ENST00000593731.1; ENST00000464016.3; ENST00000617130.4; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428377 | ||
| mod ID: M6ASITE040549 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169303-18169304:+ | [5] | |
| Sequence | CCGCCCGCTGAGCACCGAGGACCCGCCCCAAGCAGAGCCGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; U2OS; MT4; GSC-11; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428378 | ||
| mod ID: M6ASITE040550 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169369-18169370:+ | [5] | |
| Sequence | TGCGGCGGCGGGAGCCACGGACCAGACCAGCCACATCCAGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; MT4; MM6; Huh7; Jurkat; GSC-11; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428379 | ||
| mod ID: M6ASITE040552 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169374-18169375:+ | [5] | |
| Sequence | CGGCGGGAGCCACGGACCAGACCAGCCACATCCAGGGGTCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; MT4; MM6; Huh7; Jurkat; GSC-11; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000426902.5; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428380 | ||
| mod ID: M6ASITE040553 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169727-18169728:+ | [5] | |
| Sequence | CCCTGATTTTTAAGCCATAGACCTGGGGTCAGGGCAGGAAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; fibroblasts; MT4; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428381 | ||
| mod ID: M6ASITE040554 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169750-18169751:+ | [5] | |
| Sequence | TGGGGTCAGGGCAGGAAGGAACTTCACTCTGCTGCTTCCGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; ENST00000426902.5 | ||
| External Link | RMBase: m6A_site_428382 | ||
| mod ID: M6ASITE040555 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169773-18169774:+ | [5] | |
| Sequence | TCACTCTGCTGCTTCCGAGAACCTCGGCCGTGACATTCGGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428383 | ||
| mod ID: M6ASITE040556 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169785-18169786:+ | [8] | |
| Sequence | TTCCGAGAACCTCGGCCGTGACATTCGGGGCCGGGCGGGAC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428384 | ||
| mod ID: M6ASITE040557 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169804-18169805:+ | [5] | |
| Sequence | GACATTCGGGGCCGGGCGGGACCCGCCCCACAGACTCCAAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428385 | ||
| mod ID: M6ASITE040558 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169817-18169818:+ | [5] | |
| Sequence | GGGCGGGACCCGCCCCACAGACTCCAACTTCCCCTCCAAAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428386 | ||
| mod ID: M6ASITE040559 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169836-18169837:+ | [5] | |
| Sequence | GACTCCAACTTCCCCTCCAAACCCCGAAGTGAAACCCGCCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428387 | ||
| mod ID: M6ASITE040560 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169849-18169850:+ | [5] | |
| Sequence | CCTCCAAACCCCGAAGTGAAACCCGCCACCGGGTTACCCCC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000426902.5; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428388 | ||
| mod ID: M6ASITE040561 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169870-18169871:+ | [7] | |
| Sequence | CCCGCCACCGGGTTACCCCCACAAGGGGGCCGCTGCGAGAA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426902.5; ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428389 | ||
| mod ID: M6ASITE040563 | Click to Show/Hide the Full List | ||
| mod site | chr19:18169919-18169920:+ | [5] | |
| Sequence | ACCCCCGAAAAAATAATTAAACTCGCAGGCCAGGCACGGTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; A549; H1A; H1B; MT4; H1299; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000426902.5; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428390 | ||
| mod ID: M6ASITE040564 | Click to Show/Hide the Full List | ||
| mod site | chr19:18170032-18170033:+ | [9] | |
| Sequence | AGCCTGGCCAAAATGGCAAAACCCCGCATCTACTAAAATAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | rmsk_4958106; ENST00000593731.1; ENST00000426902.5; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428391 | ||
| mod ID: M6ASITE040565 | Click to Show/Hide the Full List | ||
| mod site | chr19:18170187-18170188:+ | [8] | |
| Sequence | ACTGCACTCCAGCCTGGGTAACAGAGGGAGACTCCTCCGTC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1; rmsk_4958106 | ||
| External Link | RMBase: m6A_site_428392 | ||
| mod ID: M6ASITE040566 | Click to Show/Hide the Full List | ||
| mod site | chr19:18170262-18170263:+ | [8] | |
| Sequence | CCCAACCCCTCCTAGGAATCACAGCTCCCCGTACTGGTGCC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428393 | ||
| mod ID: M6ASITE040567 | Click to Show/Hide the Full List | ||
| mod site | chr19:18170417-18170418:+ | [10] | |
| Sequence | CTTTCCTCTCCTCTTTTGGGACAAGAGCCCTGGTTTTCTAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13 | ||
| External Link | RMBase: m6A_site_428394 | ||
| mod ID: M6ASITE040568 | Click to Show/Hide the Full List | ||
| mod site | chr19:18170491-18170492:+ | [7] | |
| Sequence | AGCTGGGAGGCAGGTTTTGTACGGTACGTTGTTATTGATAT | ||
| Motif Score | 2.830077381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428395 | ||
| mod ID: M6ASITE040569 | Click to Show/Hide the Full List | ||
| mod site | chr19:18170520-18170521:+ | [10] | |
| Sequence | TGTTATTGATATGATATAAAACATCAAACGTCGTGGGTGAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000222254.13; ENST00000593731.1 | ||
| External Link | RMBase: m6A_site_428396 | ||
2'-O-Methylation (2'-O-Me)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000198 | Click to Show/Hide the Full List | ||
| mod site | chr19:18155753-18155754:+ | [11] | |
| Sequence | CTGTGGTCGCCTGTGACTGCTGGAGATAGAGGTCCCAGCAC | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000593731.1; ENST00000222254.13; ENST00000426902.5 | ||
| External Link | RMBase: Nm_site_2821 | ||
References

