General Information of the m6A Target Gene (ID: M6ATAR00349)
Target Name Glutamate receptor ionotropic, NMDA 1 (NMDAR1/GRIN1)
Synonyms
GluN1; Glutamate [NMDA] receptor subunit zeta-1; N-methyl-D-aspartate receptor subunit NR1; NMD-R1; NMDAR1
    Click to Show/Hide
Gene Name GRIN1
Chromosomal Location 9q34.3
Family glutamate-gated ion channel (TC 1;A;10;1) family; NR1/GRIN1 subfamily
Function
Component of NMDA receptor complexes that function as heterotetrameric, ligand-gated ion channels with high calcium permeability and voltage-dependent sensitivity to magnesium. Channel activation requires binding of the neurotransmitter glutamate to the epsilon subunit, glycine binding to the zeta subunit, plus membrane depolarization to eliminate channel inhibition by Mg(2+). Sensitivity to glutamate and channel kinetics depend on the subunit composition.
    Click to Show/Hide
Gene ID 2902
Uniprot ID
NMDZ1_HUMAN
HGNC ID
HGNC:4584
KEGG ID
hsa:2902
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
GRIN1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line UMRC2 cell line Homo sapiens
Treatment: FTO knockdown UMRC2 cells
Control: Wild type UMRC2 cells
GSE139123
Regulation
logFC: -9.35E-01
p-value: 3.38E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Decreased m6A in dopaminergic cells by overexpressing a nucleic acid demethylase, FTO, or by m6A inhibitor. m6A reduction could induce the expression of Glutamate receptor ionotropic, NMDA 1 (NMDAR1/GRIN1), and elevate oxidative stress and Ca2+ influx, resulting in dopaminergic neuron apoptosis. m6A modification plays a vital role in the death of dopaminergic neuron, which provides a novel view of mRNA methylation to understand the epigenetic regulation of Parkinson's disease.
Target Regulation Up regulation
Responsed Disease Parkinson disease ICD-11: 8A00
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
PC-12 Lung papillary adenocarcinoma Homo sapiens CVCL_S979
SH-SY5Y Neuroblastoma Homo sapiens CVCL_0019
In-vivo Model Two weeks after the stereotaxic surgery, all the animals were intraperitoneally injected with apomorphine at a dose of 0.5 mg/kg to induce the contralateral rotations. Ten minutes after the injection, a video was used to record the rotations of each rat for 20 min. Only those 6-OHDA induced rats showing robust contralateral turning (>7 turns/min) that were injected with 6-OHDA were used in subsequent experiments.
Parkinson disease [ICD-11: 8A00]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Decreased m6A in dopaminergic cells by overexpressing a nucleic acid demethylase, FTO, or by m6A inhibitor. m6A reduction could induce the expression of Glutamate receptor ionotropic, NMDA 1 (NMDAR1/GRIN1), and elevate oxidative stress and Ca2+ influx, resulting in dopaminergic neuron apoptosis. m6A modification plays a vital role in the death of dopaminergic neuron, which provides a novel view of mRNA methylation to understand the epigenetic regulation of Parkinson's disease.
Responsed Disease Parkinson disease [ICD-11: 8A00]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
PC-12 Lung papillary adenocarcinoma Homo sapiens CVCL_S979
SH-SY5Y Neuroblastoma Homo sapiens CVCL_0019
In-vivo Model Two weeks after the stereotaxic surgery, all the animals were intraperitoneally injected with apomorphine at a dose of 0.5 mg/kg to induce the contralateral rotations. Ten minutes after the injection, a video was used to record the rotations of each rat for 20 min. Only those 6-OHDA induced rats showing robust contralateral turning (>7 turns/min) that were injected with 6-OHDA were used in subsequent experiments.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00349)
Glutamate receptor ionotropic, NMDA 1 (NMDAR1/GRIN1)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003293 Click to Show/Hide the Full List
mod site chr9:137146917-137146918:+ [2]
Sequence GACCAGAGGGTCCTGGGAGTACTGTCGTGGGGGGTCTGCTG
Transcript ID List ENST00000371546.8; ENST00000371560.4; ENST00000350902.9; ENST00000371559.8; ENST00000371550.8; ENST00000371553.7; ENST00000471122.5; ENST00000371555.8; ENST00000371561.8
External Link RMBase: RNA-editing_site_139104
mod ID: A2ISITE003294 Click to Show/Hide the Full List
mod site chr9:137166582-137166583:+ [2]
Sequence CTTGGCATCAAGCAAGCCAAATCCCGAGATGAAGCCACCAG
Transcript ID List ENST00000371561.8; ENST00000473811.1; ENST00000371559.8; ENST00000371546.8; ENST00000371550.8; ENST00000371560.4; ENST00000371555.8; ENST00000371553.7
External Link RMBase: RNA-editing_site_139105
N6-methyladenosine (m6A)
In total 33 m6A sequence/site(s) in this target gene
mod ID: M6ASITE090580 Click to Show/Hide the Full List
mod site chr9:137139634-137139635:+ [3]
Sequence CGAGGCCGTGAACCAGGCCAACAAGCGGCACGGCTCCTGGA
Motif Score 2.173910714
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000371553.7; ENST00000371550.8; ENST00000371561.8; ENST00000371546.8; ENST00000471122.5; ENST00000371555.8; ENST00000350902.9; ENST00000371559.8; ENST00000371560.4
External Link RMBase: m6A_site_849022
mod ID: M6ASITE090581 Click to Show/Hide the Full List
mod site chr9:137139727-137139728:+ [4]
Sequence GGCTCTGTCGGTGTGCGAGGACCTCATCTCCAGCCAGGTGC
Motif Score 3.622404762
Cell/Tissue List Brain
Seq Type List m6A-seq
Transcript ID List ENST00000350902.9; ENST00000371561.8; ENST00000371550.8; ENST00000471122.5; ENST00000371560.4; ENST00000371553.7; ENST00000371559.8; ENST00000371555.8; ENST00000371546.8
External Link RMBase: m6A_site_849023
mod ID: M6ASITE090582 Click to Show/Hide the Full List
mod site chr9:137156967-137156968:+ [3]
Sequence CGAGCTCCTCGAGAAGGAGAACATCACCGACCCGCCGCGGG
Motif Score 2.951386905
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000371550.8; ENST00000371546.8; ENST00000371553.7; ENST00000371555.8; ENST00000371561.8; ENST00000471122.5; ENST00000371560.4; ENST00000350902.9; ENST00000371559.8
External Link RMBase: m6A_site_849024
mod ID: M6ASITE090583 Click to Show/Hide the Full List
mod site chr9:137161353-137161354:+
Sequence TGCTCATCAAGCTGGCACGGACCATGAACTTCACCTACGAG
Motif Score 3.622404762
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000371553.7; ENST00000471122.5; ENST00000371559.8; ENST00000371560.4; ENST00000371555.8; ENST00000350902.9; ENST00000371550.8; ENST00000371546.8; ENST00000371561.8
External Link RMBase: m6A_site_849025
mod ID: M6ASITE090584 Click to Show/Hide the Full List
mod site chr9:137162193-137162194:+ [5]
Sequence GATTCCCCGGAGCACGCTGGACTCGTTCATGCAGCCGTTCC
Motif Score 4.065041667
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000371561.8; ENST00000371550.8; ENST00000371546.8; ENST00000471122.5; ENST00000371560.4; ENST00000371555.8; ENST00000350902.9; ENST00000371559.8; ENST00000371553.7
External Link RMBase: m6A_site_849026
mod ID: M6ASITE090585 Click to Show/Hide the Full List
mod site chr9:137162280-137162281:+ [6]
Sequence CGTGATGCTGTACCTGCTGGACCGCTTCAGGTGAGCGCGAC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371560.4; ENST00000471122.5; ENST00000371555.8; ENST00000371550.8; ENST00000371553.7; ENST00000350902.9; ENST00000371561.8; ENST00000371546.8; ENST00000371559.8
External Link RMBase: m6A_site_849027
mod ID: M6ASITE090586 Click to Show/Hide the Full List
mod site chr9:137162426-137162427:+ [6]
Sequence CTTCGGCCGGTTCAAGGTGAACAGCGAGGAGGAGGAGGAGG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000350902.9; ENST00000371560.4; ENST00000471122.5; ENST00000371550.8; ENST00000371561.8; ENST00000371559.8; ENST00000371555.8; ENST00000371546.8; ENST00000371553.7
External Link RMBase: m6A_site_849028
mod ID: M6ASITE090587 Click to Show/Hide the Full List
mod site chr9:137162698-137162699:+ [6]
Sequence GGCGGCCTTCCTGGTGCTGGACCGGCCGGAGGAGCGCATCA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371550.8; ENST00000371553.7; ENST00000350902.9; ENST00000471122.5; ENST00000371561.8; ENST00000371560.4; ENST00000371546.8; ENST00000371555.8; ENST00000371559.8
External Link RMBase: m6A_site_849029
mod ID: M6ASITE090588 Click to Show/Hide the Full List
mod site chr9:137163290-137163291:+ [6]
Sequence CGGCATAGGCATGCGCAAAGACAGCCCCTGGAAGCAGAACG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000460273.1; ENST00000371561.8; ENST00000350902.9; ENST00000371559.8; ENST00000371550.8; ENST00000471122.5; ENST00000371546.8; ENST00000371560.4; ENST00000371553.7; ENST00000371555.8
External Link RMBase: m6A_site_849030
mod ID: M6ASITE090589 Click to Show/Hide the Full List
mod site chr9:137163659-137163660:+ [6]
Sequence TGCGACCCTTACTTTTGAGAACATGGCCGGTGCGTTCTCCT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371561.8; ENST00000371553.7; ENST00000371559.8; ENST00000371555.8; ENST00000471122.5; ENST00000460273.1; ENST00000350902.9; ENST00000371560.4; ENST00000371550.8; ENST00000371546.8
External Link RMBase: m6A_site_849031
mod ID: M6ASITE090590 Click to Show/Hide the Full List
mod site chr9:137163896-137163897:+ [6]
Sequence CGTTAACGTGTGGCGGAAGAACCTGCAGGTAGGGCAGGCCA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000460273.1; ENST00000371546.8; ENST00000371555.8; ENST00000371561.8; ENST00000371559.8; ENST00000371550.8; ENST00000371553.7; ENST00000371560.4; ENST00000350902.9; ENST00000471122.5
External Link RMBase: m6A_site_849032
mod ID: M6ASITE090591 Click to Show/Hide the Full List
mod site chr9:137164009-137164010:+ [6]
Sequence CTCTGGCTCTGGTGGGCAGGACTGGAGCTAGGAGCCATGGC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371560.4; ENST00000350902.9; ENST00000460273.1; ENST00000371553.7; ENST00000371550.8; ENST00000371559.8; ENST00000471122.5; ENST00000371546.8; ENST00000371555.8; ENST00000371561.8
External Link RMBase: m6A_site_849033
mod ID: M6ASITE090592 Click to Show/Hide the Full List
mod site chr9:137164220-137164221:+ [6]
Sequence AGGCAATCAGGCAGGGTAAGACAGGGGCCCGCCTGTGTATG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371546.8; ENST00000471122.5; ENST00000371561.8; ENST00000371553.7; ENST00000371560.4; ENST00000350902.9; ENST00000371555.8; ENST00000371550.8; ENST00000371559.8
External Link RMBase: m6A_site_849034
mod ID: M6ASITE090593 Click to Show/Hide the Full List
mod site chr9:137164303-137164304:+ [6]
Sequence CCCCTTGACACCCTTCGGAGACCCCCCCCTTTCCTGCTATG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371559.8; ENST00000371550.8; ENST00000371555.8; ENST00000371561.8; ENST00000371553.7; ENST00000371546.8; ENST00000471122.5; ENST00000350902.9; ENST00000371560.4
External Link RMBase: m6A_site_849035
mod ID: M6ASITE090594 Click to Show/Hide the Full List
mod site chr9:137164436-137164437:+ [6]
Sequence GCAGCCACGGCCCACCTGGGACAGGGTGGGCAGTGGGCCTG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; HepG2; peripheral-blood; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000350902.9; ENST00000371550.8; ENST00000371546.8; ENST00000471122.5; ENST00000371560.4; ENST00000371555.8; ENST00000371553.7; ENST00000371561.8; ENST00000371559.8
External Link RMBase: m6A_site_849036
mod ID: M6ASITE090595 Click to Show/Hide the Full List
mod site chr9:137164656-137164657:+ [6]
Sequence CCCCCACAGGTCCCCTGGGGACCTGGCCGCTGCCAGCACTG
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371555.8; ENST00000371550.8; ENST00000371561.8; ENST00000371560.4; ENST00000471122.5; ENST00000371553.7; ENST00000371559.8; ENST00000371546.8; ENST00000350902.9
External Link RMBase: m6A_site_849037
mod ID: M6ASITE090596 Click to Show/Hide the Full List
mod site chr9:137164703-137164704:+ [6]
Sequence ACAGGCCACCTGGCCATCAGACCTGAGGCCAGAGTCCCGGG
Motif Score 2.876744048
Cell/Tissue List HeLa; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000350902.9; ENST00000371555.8; ENST00000371559.8; ENST00000371550.8; ENST00000371546.8; ENST00000471122.5; ENST00000371561.8; ENST00000371560.4; ENST00000371553.7
External Link RMBase: m6A_site_849038
mod ID: M6ASITE090597 Click to Show/Hide the Full List
mod site chr9:137164828-137164829:+ [6]
Sequence GGTCAGTGGCCTCCACGCAGACAGCTGGTGTGGCCTGAGGG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371555.8; ENST00000371560.4; ENST00000471122.5; ENST00000371559.8; ENST00000371546.8; ENST00000371550.8; ENST00000371553.7; ENST00000371561.8; ENST00000350902.9
External Link RMBase: m6A_site_849039
mod ID: M6ASITE090598 Click to Show/Hide the Full List
mod site chr9:137164872-137164873:+ [6]
Sequence ACTCCTCCAGTCCTCAGAGGACTCCTCCTCCTCGGGACGCC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371546.8; ENST00000371555.8; ENST00000471122.5; ENST00000371560.4; ENST00000371550.8; ENST00000371561.8; ENST00000350902.9; ENST00000371553.7; ENST00000371559.8
External Link RMBase: m6A_site_849040
mod ID: M6ASITE090599 Click to Show/Hide the Full List
mod site chr9:137164932-137164933:+ [6]
Sequence GGAGCCAGGGAGCCAGGCGGACCTCCCAGGAAGAGCCAGCC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371559.8; ENST00000350902.9; ENST00000371553.7; ENST00000371546.8; ENST00000371550.8; ENST00000371555.8; ENST00000471122.5; ENST00000371561.8; ENST00000371560.4
External Link RMBase: m6A_site_849041
mod ID: M6ASITE090600 Click to Show/Hide the Full List
mod site chr9:137164999-137165000:+ [6]
Sequence CGAGCAAGGTCAGGCCCGAGACCCCGGGCAGGAGAAGAGGC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000350902.9; ENST00000371559.8; ENST00000371561.8; ENST00000371550.8; ENST00000371560.4; ENST00000371553.7; ENST00000371555.8; ENST00000471122.5; ENST00000371546.8
External Link RMBase: m6A_site_849042
mod ID: M6ASITE090601 Click to Show/Hide the Full List
mod site chr9:137165291-137165292:+ [6]
Sequence GAGGCGTAGGTCCTCCAAAGACACGGTAAGGGGGAGAGCAC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000471122.5; ENST00000350902.9; ENST00000473811.1; ENST00000371546.8; ENST00000371555.8; ENST00000371553.7; ENST00000371550.8; ENST00000371561.8; ENST00000371560.4; ENST00000371559.8
External Link RMBase: m6A_site_849043
mod ID: M6ASITE090602 Click to Show/Hide the Full List
mod site chr9:137165380-137165381:+ [6]
Sequence GCCCCATCACCCCGCCCCGGACCCTGGGCTCCTGTGGCCCA
Motif Score 3.622404762
Cell/Tissue List HeLa; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371559.8; ENST00000471122.5; ENST00000350902.9; ENST00000371553.7; ENST00000371555.8; ENST00000473811.1; ENST00000371550.8; ENST00000371561.8; ENST00000371560.4; ENST00000371546.8
External Link RMBase: m6A_site_849044
mod ID: M6ASITE090603 Click to Show/Hide the Full List
mod site chr9:137167441-137167442:+ [6]
Sequence TGGACGCGGCGCTTTGCAAAACCAAAAAGACACAGTGCTGC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000473811.1; ENST00000371546.8; ENST00000371550.8; ENST00000371560.4; ENST00000371561.8; ENST00000371553.7; ENST00000371559.8; ENST00000371555.8
External Link RMBase: m6A_site_849045
mod ID: M6ASITE090604 Click to Show/Hide the Full List
mod site chr9:137167450-137167451:+ [6]
Sequence CGCTTTGCAAAACCAAAAAGACACAGTGCTGCCGCGACGCG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371546.8; ENST00000371550.8; ENST00000371561.8; ENST00000371559.8; ENST00000473811.1; ENST00000371553.7; ENST00000371560.4; ENST00000371555.8
External Link RMBase: m6A_site_849046
mod ID: M6ASITE090605 Click to Show/Hide the Full List
mod site chr9:137167528-137167529:+ [6]
Sequence CCGTCATAGGGAGAGCTGAGACTCCCCGCCCGCCCTCCTCT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000371553.7; ENST00000371555.8; ENST00000371561.8; ENST00000371559.8; ENST00000371560.4; ENST00000371546.8; ENST00000473811.1; ENST00000371550.8
External Link RMBase: m6A_site_849047
mod ID: M6ASITE090606 Click to Show/Hide the Full List
mod site chr9:137167884-137167885:+ [6]
Sequence CCCAGTTAGCCCGGCCAAGGACACTGATGGGTCCTGCTGCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000371546.8; ENST00000371559.8; ENST00000371560.4; ENST00000371555.8; ENST00000371553.7; ENST00000371561.8; ENST00000371550.8
External Link RMBase: m6A_site_849048
mod ID: M6ASITE090607 Click to Show/Hide the Full List
mod site chr9:137167940-137167941:+ [7]
Sequence GAAGCCCACCCGCCCCAGAGACTGCCCACCCTGGGCCTCCC
Motif Score 3.319380952
Cell/Tissue List GSC-11; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000371560.4; ENST00000462584.1; ENST00000371553.7; ENST00000371561.8; ENST00000371559.8; ENST00000371550.8; ENST00000371555.8; ENST00000371546.8
External Link RMBase: m6A_site_849049
mod ID: M6ASITE090608 Click to Show/Hide the Full List
mod site chr9:137168008-137168009:+ [8]
Sequence TGGCGGGCAGCCCCTGCTGGACCAAGGTGCGGACCGGAGCG
Motif Score 3.622404762
Cell/Tissue List H1B; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000371550.8; ENST00000371559.8; ENST00000371546.8; ENST00000462584.1; ENST00000371561.8; ENST00000371555.8; ENST00000371553.7; ENST00000371560.4
External Link RMBase: m6A_site_849050
mod ID: M6ASITE090609 Click to Show/Hide the Full List
mod site chr9:137168020-137168021:+ [8]
Sequence CCTGCTGGACCAAGGTGCGGACCGGAGCGGCTGAGGACGGG
Motif Score 3.622404762
Cell/Tissue List H1B; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000371553.7; ENST00000371550.8; ENST00000462584.1; ENST00000371559.8; ENST00000371555.8; ENST00000371561.8; ENST00000371560.4; ENST00000371546.8
External Link RMBase: m6A_site_849051
mod ID: M6ASITE090610 Click to Show/Hide the Full List
mod site chr9:137168419-137168420:+ [6]
Sequence CCTCGGGCCGCCTCCTCCAGACTCGAGAGGGCTGAGCCCCT
Motif Score 3.319380952
Cell/Tissue List HeLa; H1B; H1A; GSC-11
Seq Type List m6A-seq
Transcript ID List ENST00000371550.8; ENST00000371560.4; ENST00000371553.7; ENST00000462584.1; ENST00000371561.8; ENST00000371559.8; ENST00000371546.8; ENST00000371555.8
External Link RMBase: m6A_site_849052
mod ID: M6ASITE090611 Click to Show/Hide the Full List
mod site chr9:137168505-137168506:+ [6]
Sequence TCCCCGGACGCTGGCTCGGGACTGTCTTCAACCCTGCCCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; H1A; H1B; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000462584.1; ENST00000371546.8; ENST00000371559.8; ENST00000371553.7; ENST00000371560.4; ENST00000371555.8; ENST00000371550.8; ENST00000371561.8
External Link RMBase: m6A_site_849053
mod ID: M6ASITE090612 Click to Show/Hide the Full List
mod site chr9:137168606-137168607:+ [6]
Sequence GGCCCGCCACCTTGTACAGAACCAGCACTCCCAGGGCCCGA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371559.8; ENST00000462584.1; ENST00000371550.8; ENST00000371560.4; ENST00000371561.8; ENST00000371555.8; ENST00000371553.7; ENST00000371546.8
External Link RMBase: m6A_site_849054