m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00345)

Target Name	RMRP
Synonyms	RMRPR; RRP2; NME1; RNase MRP RNA Click to Show/Hide
Gene Name	NME1
Chromosomal Location	9p13.3
Family	RNase MRP complex subunits
Gene ID	6023
HGNC ID	HGNC:10031

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

NME1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	143B cell line	Homo sapiens
Treatment: siALKBH5 transfected 143B cells Control: siControl 143B cells		GSE154528
Regulation		logFC: -1.09E+00 p-value: 4.52E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	ALKBH5 knockdown, was able to inhibit malignant behavior of lung adenocarcinoma by regulating RMRP expression via demethylation. RMRP and ALKBH5 therefore represent promising therapeutic targets for lung adenocarcinoma.
Target Regulation	Up regulation
Responsed Disease	Lung adenocarcinoma		ICD-11: 2C25.0	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	XWLC-05	Lung adenocarcinoma	Homo sapiens	CVCL_IQ71
In-vivo Model	The mice were maintained in cages under standard environmental conditions (temperature 25 ± 2 ℃, humidity 55 ± 5% and 12-h light/12-h dark cycle) and given free access to food and tap water. All mice were randomly divided into three groups with 6 in each group. To establish xenograft model, A549 cells (1 × 10⁷) transfected with si-control (si-NC), si-ALKBH5 or si-ALKBH5 + RMRP were injected subcutaneously into a single side of the armpit of each mouse.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[]
Response Summary	m6A RNA methylation-mediated RMRP stability renders proliferation and progression of non-small cell lung cancer through regulating TGFBR1/SMAD2/SMAD3 pathway. RMRP promoted the cancer stem cells properties and epithelial mesenchymal transition, which promote the resistance to radiation therapy and cisplatin.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	Signaling pathways regulating pluripotency of stem cells			hsa04550
	EGFR tyrosine kinase inhibitor resistance			hsa01521
Cell Process	Epithelial mesenchymal transition
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	ALKBH5 knockdown, was able to inhibit malignant behavior of lung adenocarcinoma by regulating RMRP expression via demethylation. RMRP and ALKBH5 therefore represent promising therapeutic targets for lung adenocarcinoma.
Responsed Disease	Lung adenocarcinoma [ICD-11: 2C25.0]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	XWLC-05	Lung adenocarcinoma	Homo sapiens	CVCL_IQ71
In-vivo Model	The mice were maintained in cages under standard environmental conditions (temperature 25 ± 2 ℃, humidity 55 ± 5% and 12-h light/12-h dark cycle) and given free access to food and tap water. All mice were randomly divided into three groups with 6 in each group. To establish xenograft model, A549 cells (1 × 10⁷) transfected with si-control (si-NC), si-ALKBH5 or si-ALKBH5 + RMRP were injected subcutaneously into a single side of the armpit of each mouse.

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response			[]
Response Summary	m6A RNA methylation-mediated RMRP stability renders proliferation and progression of non-small cell lung cancer through regulating TGFBR1/SMAD2/SMAD3 pathway. RMRP promoted the cancer stem cells properties and epithelial mesenchymal transition, which promote the resistance to radiation therapy and cisplatin.
Responsed Disease	Non-small-cell lung carcinoma	ICD-11: 2C25.Y	Disease Info
Pathway Response	Signaling pathways regulating pluripotency of stem cells		hsa04550
	EGFR tyrosine kinase inhibitor resistance		hsa01521
Cell Process	Epithelial mesenchymal transition

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05493		Crosstalk Info
Epigenetic Regulator	RMRP
Crosstalk relationship	m6A → ncRNA
Disease	Lung cancer	Disease Info
Crosstalk ID: M6ACROT05677		Crosstalk Info
Epigenetic Regulator	RMRP
Crosstalk relationship	m6A → ncRNA
Disease	Ovarian cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00345)

RMRP

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000229		Click to Show/Hide the Full List
mod site	chr17:51154279-51154280:+		[3]
Sequence	GACTAAGTCAGCCTGGTGTGCAGGGGAGGCAGACACACAAA
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000456492.1; ENST00000393196.7; ENST00000376392.10; ENST00000393193.6; ENST00000013034.3; ENST00000487481.1; ENST00000555572.1; ENST00000475573.5; ENST00000512768.1; ENST00000336097.7; ENST00000480143.5; ENST00000511355.5
External Link	RMBase: ac4C_site_822

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000166		Click to Show/Hide the Full List
mod site	chr17:51161226-51161227:+		[4]
Sequence	GGAGACCAACCCTGCAGACTCCAAGCCTGGGACCATCCGTG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000555572.1; ENST00000480143.5; ENST00000336097.7; ENST00000511355.5; ENST00000393196.7; ENST00000013034.3; ENST00000393193.6; ENST00000376392.10; ENST00000475573.5
External Link	RMBase: Nm_site_2517

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001236		Click to Show/Hide the Full List
mod site	chr17:51161723-51161724:+		[5]
Sequence	GTGACTATCTCTTTCTCCACCCAGGAACATTATACATGGCA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000555572.1; ENST00000376392.10; ENST00000511355.5; ENST00000336097.7; ENST00000393196.7; ENST00000393193.6; ENST00000475573.5; ENST00000013034.3
External Link	RMBase: m5C_site_19491
mod ID: M5CSITE001237		Click to Show/Hide the Full List
mod site	chr17:51161724-51161725:+		[5]
Sequence	TGACTATCTCTTTCTCCACCCAGGAACATTATACATGGCAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000393196.7; ENST00000555572.1; ENST00000393193.6; ENST00000013034.3; ENST00000475573.5; ENST00000376392.10; ENST00000511355.5; ENST00000336097.7
External Link	RMBase: m5C_site_19492
mod ID: M5CSITE001238		Click to Show/Hide the Full List
mod site	chr17:51161858-51161859:+		[5]
Sequence	TGAATGACAGGAGGGCAGACCACATTGCTTTTCACATCCAT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000555572.1; ENST00000475573.5; ENST00000336097.7; ENST00000376392.10; ENST00000511355.5; ENST00000013034.3; ENST00000393196.7; ENST00000393193.6
External Link	RMBase: m5C_site_19493

N6-methyladenosine (m6A)

In total 29 m6A sequence/site(s) in this target gene
mod ID: M6ASITE034228		Click to Show/Hide the Full List
mod site	chr17:51153590-51153591:+		[6]
Sequence	CGTGCGTGCAAGTGCTGCGAACCACGTGGGTCCCGGGCGCG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1B; A549; MM6; MSC; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000480143.5; ENST00000393196.7; ENST00000336097.7; ENST00000512768.1; ENST00000487481.1; ENST00000393193.6; ENST00000511355.5
External Link	RMBase: m6A_site_372072
mod ID: M6ASITE034229		Click to Show/Hide the Full List
mod site	chr17:51153644-51153645:+		[6]
Sequence	CGGCTGCAGCCGGAGTTCAAACCTAAGCAGCTGGAAGGGTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; H1B; A549; MM6; Huh7; HEK293T; MSC; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000480143.5; ENST00000511355.5; ENST00000512768.1; ENST00000393193.6; ENST00000376392.10; ENST00000487481.1; ENST00000475573.5; ENST00000336097.7; ENST00000555572.1; ENST00000393196.7
External Link	RMBase: m6A_site_372073
mod ID: M6ASITE034230		Click to Show/Hide the Full List
mod site	chr17:51154045-51154046:+		[6]
Sequence	ACCGGGACCGATGTGGAGGGACATTTTTAGGGTGTATTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; MM6; MSC; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000393196.7; ENST00000376392.10; ENST00000456492.1; ENST00000480143.5; ENST00000475573.5; ENST00000555572.1; ENST00000512768.1; ENST00000511355.5; ENST00000013034.3; ENST00000336097.7; ENST00000393193.6; ENST00000487481.1
External Link	RMBase: m6A_site_372074
mod ID: M6ASITE034231		Click to Show/Hide the Full List
mod site	chr17:51154092-51154093:+		[6]
Sequence	TTAGTCCTGTTTTCTCCTGGACAATTTATGCTTGCCCCGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000393196.7; ENST00000512768.1; ENST00000393193.6; ENST00000013034.3; ENST00000487481.1; ENST00000480143.5; ENST00000555572.1; ENST00000475573.5; ENST00000336097.7; ENST00000376392.10; ENST00000511355.5; ENST00000456492.1
External Link	RMBase: m6A_site_372075
mod ID: M6ASITE034232		Click to Show/Hide the Full List
mod site	chr17:51154260-51154261:+		[7]
Sequence	CCATAGAGTCTCTACACAGGACTAAGTCAGCCTGGTGTGCA
Motif Score	4.065041667
Cell/Tissue List	HepG2; HeLa; A549; fibroblasts; MM6; Huh7; GSC-11; HEK293T; MSC; TREX; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000555572.1; ENST00000393196.7; ENST00000511355.5; ENST00000487481.1; ENST00000376392.10; ENST00000475573.5; ENST00000512768.1; ENST00000480143.5; ENST00000336097.7; ENST00000013034.3; ENST00000393193.6; ENST00000456492.1
External Link	RMBase: m6A_site_372076
mod ID: M6ASITE034233		Click to Show/Hide the Full List
mod site	chr17:51154291-51154292:+		[7]
Sequence	CTGGTGTGCAGGGGAGGCAGACACACAAACAGAAAATTGGA
Motif Score	2.897386905
Cell/Tissue List	HepG2; HeLa; A549; fibroblasts; MM6; Huh7; HEK293T; MSC; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000487481.1; ENST00000475573.5; ENST00000393196.7; ENST00000336097.7; ENST00000480143.5; ENST00000512768.1; ENST00000456492.1; ENST00000013034.3; ENST00000511355.5; ENST00000555572.1; ENST00000376392.10; ENST00000393193.6
External Link	RMBase: m6A_site_372077
mod ID: M6ASITE034234		Click to Show/Hide the Full List
mod site	chr17:51154299-51154300:+		[7]
Sequence	CAGGGGAGGCAGACACACAAACAGAAAATTGGACTACAGTG
Motif Score	2.20572619
Cell/Tissue List	HepG2; HeLa; A549; fibroblasts; MM6; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000480143.5; ENST00000475573.5; ENST00000336097.7; ENST00000393196.7; ENST00000555572.1; ENST00000456492.1; ENST00000013034.3; ENST00000511355.5; ENST00000487481.1; ENST00000393193.6; ENST00000376392.10; ENST00000512768.1
External Link	RMBase: m6A_site_372078
mod ID: M6ASITE034235		Click to Show/Hide the Full List
mod site	chr17:51154311-51154312:+		[7]
Sequence	ACACACAAACAGAAAATTGGACTACAGTGCTAAGATGCTGT
Motif Score	4.065041667
Cell/Tissue List	HepG2; HeLa; A549; MM6; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000512768.1; ENST00000013034.3; ENST00000393196.7; ENST00000456492.1; ENST00000475573.5; ENST00000555572.1; ENST00000480143.5; ENST00000336097.7; ENST00000487481.1; ENST00000393193.6; ENST00000376392.10; ENST00000511355.5
External Link	RMBase: m6A_site_372079
mod ID: M6ASITE034236		Click to Show/Hide the Full List
mod site	chr17:51154352-51154353:+		[7]
Sequence	AAGAAGAGGTTAACTAAAGGACAGGAAGATGGGGCCAAGAG
Motif Score	3.643047619
Cell/Tissue List	HepG2; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000487481.1; ENST00000393193.6; ENST00000512768.1; ENST00000480143.5; ENST00000465188.1; ENST00000336097.7; ENST00000376392.10; ENST00000013034.3; ENST00000555572.1; ENST00000511355.5; ENST00000456492.1; ENST00000475573.5; ENST00000393196.7
External Link	RMBase: m6A_site_372080
mod ID: M6ASITE034237		Click to Show/Hide the Full List
mod site	chr17:51155689-51155690:+		[8]
Sequence	CGTACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGG
Motif Score	2.185083333
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000393196.7; ENST00000465188.1; ENST00000475573.5; ENST00000512768.1; ENST00000480143.5; ENST00000376392.10; ENST00000456492.1; ENST00000393193.6; ENST00000555572.1; ENST00000511355.5; ENST00000013034.3; ENST00000487481.1; ENST00000336097.7
External Link	RMBase: m6A_site_372081
mod ID: M6ASITE034238		Click to Show/Hide the Full List
mod site	chr17:51160002-51160003:+		[9]
Sequence	TCCGAAGATCTTCTCAAGGAACACTACGTTGACCTGAAGGA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; HepG2; endometrial
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000013034.3; ENST00000376392.10; ENST00000555572.1; ENST00000511355.5; ENST00000475573.5; ENST00000512768.1; ENST00000393196.7; ENST00000393193.6; ENST00000336097.7; ENST00000480143.5
External Link	RMBase: m6A_site_372082
mod ID: M6ASITE034239		Click to Show/Hide the Full List
mod site	chr17:51160022-51160023:+		[8]
Sequence	ACACTACGTTGACCTGAAGGACCGTCCATTCTTTGCCGGCC
Motif Score	3.622404762
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000511355.5; ENST00000555572.1; ENST00000475573.5; ENST00000480143.5; ENST00000013034.3; ENST00000376392.10; ENST00000393193.6; ENST00000512768.1; ENST00000393196.7; ENST00000336097.7
External Link	RMBase: m6A_site_372083
mod ID: M6ASITE034240		Click to Show/Hide the Full List
mod site	chr17:51160052-51160053:+		[9]
Sequence	CTTTGCCGGCCTGGTGAAATACATGCACTCAGGGCCGGTAG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000475573.5; ENST00000376392.10; ENST00000336097.7; ENST00000393196.7; ENST00000480143.5; ENST00000512768.1; ENST00000013034.3; ENST00000555572.1; ENST00000393193.6; ENST00000511355.5
External Link	RMBase: m6A_site_372084
mod ID: M6ASITE034241		Click to Show/Hide the Full List
mod site	chr17:51161210-51161211:+		[10]
Sequence	GCCGAGTCATGCTCGGGGAGACCAACCCTGCAGACTCCAAG
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HepG2; peripheral-blood; endometrial; NB4
Seq Type List	DART-seq; m6A-seq
Transcript ID List	ENST00000393196.7; ENST00000393193.6; ENST00000480143.5; ENST00000475573.5; ENST00000555572.1; ENST00000376392.10; ENST00000336097.7; ENST00000013034.3; ENST00000511355.5
External Link	RMBase: m6A_site_372085
mod ID: M6ASITE034242		Click to Show/Hide the Full List
mod site	chr17:51161223-51161224:+		[8]
Sequence	CGGGGAGACCAACCCTGCAGACTCCAAGCCTGGGACCATCC
Motif Score	3.319380952
Cell/Tissue List	HepG2; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000376392.10; ENST00000555572.1; ENST00000393196.7; ENST00000480143.5; ENST00000336097.7; ENST00000511355.5; ENST00000475573.5; ENST00000393193.6; ENST00000013034.3
External Link	RMBase: m6A_site_372086
mod ID: M6ASITE034243		Click to Show/Hide the Full List
mod site	chr17:51161237-51161238:+		[6]
Sequence	CTGCAGACTCCAAGCCTGGGACCATCCGTGGAGACTTCTGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; MM6; CD4T; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000376392.10; ENST00000393196.7; ENST00000480143.5; ENST00000013034.3; ENST00000336097.7; ENST00000511355.5; ENST00000555572.1; ENST00000393193.6; ENST00000475573.5
External Link	RMBase: m6A_site_372087
mod ID: M6ASITE034244		Click to Show/Hide the Full List
mod site	chr17:51161250-51161251:+		[6]
Sequence	GCCTGGGACCATCCGTGGAGACTTCTGCATACAAGTTGGCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; MM6; CD4T; peripheral-blood; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; DART-seq; miCLIP
Transcript ID List	ENST00000475573.5; ENST00000376392.10; ENST00000555572.1; ENST00000393196.7; ENST00000013034.3; ENST00000511355.5; ENST00000393193.6; ENST00000480143.5; ENST00000336097.7
External Link	RMBase: m6A_site_372088
mod ID: M6ASITE034245		Click to Show/Hide the Full List
mod site	chr17:51161260-51161261:+		[9]
Sequence	ATCCGTGGAGACTTCTGCATACAAGTTGGCAGGTGAGATTT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000393193.6; ENST00000393196.7; ENST00000336097.7; ENST00000013034.3; ENST00000511355.5; ENST00000555572.1; ENST00000480143.5; ENST00000376392.10; ENST00000475573.5
External Link	RMBase: m6A_site_372089
mod ID: M6ASITE034246		Click to Show/Hide the Full List
mod site	chr17:51161353-51161354:+		[6]
Sequence	GTTTCCGAGGCTGGAGGTAGACATGATACCATATGCAGGTT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000013034.3; ENST00000393196.7; ENST00000336097.7; ENST00000480143.5; ENST00000393193.6; ENST00000511355.5; ENST00000376392.10; ENST00000555572.1; ENST00000475573.5
External Link	RMBase: m6A_site_372090
mod ID: M6ASITE034247		Click to Show/Hide the Full List
mod site	chr17:51161729-51161730:+		[6]
Sequence	ATCTCTTTCTCCACCCAGGAACATTATACATGGCAGTGATT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; H1299; MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000475573.5; ENST00000336097.7; ENST00000555572.1; ENST00000376392.10; ENST00000013034.3; ENST00000511355.5; ENST00000393193.6; ENST00000393196.7
External Link	RMBase: m6A_site_372091
mod ID: M6ASITE034248		Click to Show/Hide the Full List
mod site	chr17:51161799-51161800:+		[6]
Sequence	TTGTGGTTTCACCCTGAGGAACTGGTAGATTACACGAGCTG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; H1299; MM6; endometrial
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000555572.1; ENST00000013034.3; ENST00000511355.5; ENST00000475573.5; ENST00000393196.7; ENST00000393193.6; ENST00000376392.10; ENST00000336097.7
External Link	RMBase: m6A_site_372092
mod ID: M6ASITE034249		Click to Show/Hide the Full List
mod site	chr17:51161828-51161829:+		[6]
Sequence	TTACACGAGCTGTGCTCAGAACTGGATCTATGAATGACAGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; H1299; MM6; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000393196.7; ENST00000336097.7; ENST00000376392.10; ENST00000475573.5; ENST00000393193.6; ENST00000013034.3; ENST00000555572.1; ENST00000511355.5
External Link	RMBase: m6A_site_372093
mod ID: M6ASITE034250		Click to Show/Hide the Full List
mod site	chr17:51161844-51161845:+		[10]
Sequence	CAGAACTGGATCTATGAATGACAGGAGGGCAGACCACATTG
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000393193.6; ENST00000376392.10; ENST00000475573.5; ENST00000393196.7; ENST00000511355.5; ENST00000013034.3; ENST00000336097.7; ENST00000555572.1
External Link	RMBase: m6A_site_372094
mod ID: M6ASITE034251		Click to Show/Hide the Full List
mod site	chr17:51161856-51161857:+		[6]
Sequence	TATGAATGACAGGAGGGCAGACCACATTGCTTTTCACATCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; H1299; MM6; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000475573.5; ENST00000376392.10; ENST00000336097.7; ENST00000511355.5; ENST00000393196.7; ENST00000393193.6; ENST00000013034.3; ENST00000555572.1
External Link	RMBase: m6A_site_372095
mod ID: M6ASITE034252		Click to Show/Hide the Full List
mod site	chr17:51161871-51161872:+		[10]
Sequence	GGCAGACCACATTGCTTTTCACATCCATTTCCCCTCCTTCC
Motif Score	2.047297619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000393193.6; ENST00000336097.7; ENST00000475573.5; ENST00000555572.1; ENST00000511355.5; ENST00000013034.3; ENST00000393196.7; ENST00000376392.10
External Link	RMBase: m6A_site_372096
mod ID: M6ASITE034253		Click to Show/Hide the Full List
mod site	chr17:51161904-51161905:+		[6]
Sequence	CTCCTTCCCATGGGCAGAGGACCAGGCTGTAGGAAATCTAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; H1299; MM6; endometrial; AML
Seq Type List	m6A-seq; DART-seq; miCLIP
Transcript ID List	ENST00000393193.6; ENST00000555572.1; ENST00000511355.5; ENST00000376392.10; ENST00000393196.7; ENST00000475573.5; ENST00000336097.7
External Link	RMBase: m6A_site_372097
mod ID: M6ASITE034254		Click to Show/Hide the Full List
mod site	chr17:51161931-51161932:+		[10]
Sequence	TGTAGGAAATCTAGTTATTTACAGGAACTTCATCATAATTT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000336097.7; ENST00000376392.10; ENST00000475573.5; ENST00000393193.6; ENST00000393196.7; ENST00000511355.5; ENST00000555572.1
External Link	RMBase: m6A_site_372098
mod ID: M6ASITE034255		Click to Show/Hide the Full List
mod site	chr17:51161937-51161938:+		[6]
Sequence	AAATCTAGTTATTTACAGGAACTTCATCATAATTTGGAGGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; H1299; endometrial
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000555572.1; ENST00000511355.5; ENST00000475573.5; ENST00000336097.7; ENST00000393193.6; ENST00000376392.10; ENST00000393196.7
External Link	RMBase: m6A_site_372099
mod ID: M6ASITE034256		Click to Show/Hide the Full List
mod site	chr17:51161987-51161988:+		[10]
Sequence	GAGCTGTGAGTTCTCCCTGTACAGTGTTACCATCCCCGACC
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000555572.1; ENST00000511355.5; ENST00000475573.5; ENST00000336097.7; ENST00000393193.6; ENST00000393196.7; ENST00000376392.10
External Link	RMBase: m6A_site_372100

Ref 1	ALKBH5-mediated m6A demethylation of lncRNA RMRP plays an oncogenic role in lung adenocarcinoma. Mamm Genome. 2021 Jun;32(3):195-203. doi: 10.1007/s00335-021-09872-6. Epub 2021 May 1.
Ref 2	Anti-androgen receptor ASC-J9 versus anti-androgens MDV3100 (Enzalutamide) or Casodex (Bicalutamide) leads to opposite effects on prostate cancer metastasis via differential modulation of macrophage infiltration and STAT3-CCL2 signaling. Cell Death Dis. 2013 Aug 8;4(8):e764. doi: 10.1038/cddis.2013.270.
Ref 3	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 4	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 5	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 8	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map