m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00344)

Target Name	Homeobox protein NANOG (NANOG)
Synonyms	Homeobox transcription factor Nanog; hNanog Click to Show/Hide
Gene Name	NANOG
Chromosomal Location	12p13.31
Family	Nanog homeobox family
Function	Transcription regulator involved in inner cell mass and embryonic stem (ES) cells proliferation and self-renewal. Imposes pluripotency on ES cells and prevents their differentiation towards extraembryonic endoderm and trophectoderm lineages. Blocks bone morphogenetic protein-induced mesoderm differentiation of ES cells by physically interacting with SMAD1 and interfering with the recruitment of coactivators to the active SMAD transcriptional complexes. Acts as a transcriptional activator or repressor. Binds optimally to the DNA consensus sequence 5'-TAAT[GT][GT]-3' or 5'-[CG][GA][CG]C[GC]ATTAN[GC]-3'. Binds to the POU5F1/OCT4 promoter. Able to autorepress its expression in differentiating (ES) cells: binds to its own promoter following interaction with ZNF281/ZFP281, leading to recruitment of the NuRD complex and subsequent repression of expression. When overexpressed, promotes cells to enter into S phase and proliferation. Click to Show/Hide
Gene ID	79923
Uniprot ID	NANOG_HUMAN
HGNC ID	HGNC:20857
KEGG ID	hsa:79923

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

NANOG can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Soma	Mus musculus
Treatment: Mettl3-/- soma Control: Wild type soma		GSE171199
Regulation		logFC: 2.74E+00 p-value: 4.57E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	In breast cancer, ZNF217 could upregulate Homeobox protein NANOG (NANOG) by reducing N6-methyladenosine levels via methyltransferase-like 13 (METTL3).
Target Regulation	Up regulation
Responsed Disease	Breast cancer	ICD-11: 2C60	Disease Info
Cell Process	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition initiation

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	In glioma, hsa_circ_0072083 could regulate Homeobox protein NANOG (NANOG) and ALKBH5 via targeting miR-1252-5p to control temozolomide resistance. circ_0072083 silence reduced NANOG expression via blocking ALKBH5-mediated demethylation.
Target Regulation	Up regulation
Responsed Disease	Glioma		ICD-11: 2A00.0	Disease Info
Responsed Drug	Temozolomide		Approved	Drug Info
Cell Process	Cellular Processes
	Cell growth and death
	Cell apoptosis
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	U251 (Fibroblasts or fibroblast like cells)
	U87 (A primary glioblastoma cell line)
In-vivo Model	U251/TR cells (2 × 10⁶ per mouse) with stable transfection of sh-circ_0072083 or sh-NC were subcutaneously injected into mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	Homeobox protein NANOG (NANOG) activity does not merely compensate for reduced O2 levels but significantly increases ALKBH5, JMJD2C, and TET1 activity in hypoxic breast cancer cells, leading to transcriptional and posttranscriptional changes in gene expression that promote the specification and/or maintenance of BCSCs. ALKBH5 overexpression decreased Homeobox protein NANOG (NANOG) mRNA methylation, increased NANOG levels, and increased the percentage of BCSCs,.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Signaling pathways regulating pluripotency of stem cells (hsa04550)
In-vitro Model	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-435	Amelanotic melanoma	Homo sapiens	CVCL_0417
	SUM-149 (Human breast cancer cell SUM149)
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	ZR75.1 A3	Invasive breast carcinoma	Homo sapiens	CVCL_YX82
In-vivo Model	A total of 1,000 breast cancer cells were injected into the mammary fat pad of 6-8-wk-old female NSG mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS solution. At 10 wk after injection, mice were examined for the presence of tumors, which were harvested for analysis.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	ALKBH5 knockdown in MDA-MB-231 breast cancer cells significantly decreased metastasis from breast to lungs in immunodeficient mice. ALKBH5-mediated demethylation of N6-methyladenosine (m6A) in Homeobox protein NANOG (NANOG) mRNA leading to increased expression of NANOG.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Biological regulation
Cell Process	HIF-1 signaling pathway (hsa04066)
In-vitro Model	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	SUM-149 (Human breast cancer cell SUM149)
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	ZR75.1 A3	Invasive breast carcinoma	Homo sapiens	CVCL_YX82
In-vivo Model	1,000 MDA-MB-231 subclone cells were injected into the mammary fat pad of randomly chosen 6-to-8 week-old female severe combined immunodeficiency (SCID) mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS (n = 7 mice per subclone).
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	Homeobox protein NANOG (NANOG) served as a target in ALKBH5-mediated m6A modification in ovarian cancer.
Target Regulation	Up regulation
Responsed Disease	Ovarian cancer		ICD-11: 2C73	Disease Info
Cell Process	Cell invasion
In-vitro Model	HEY	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0297
	HO-8910	Endocervical adenocarcinoma	Homo sapiens	CVCL_6868
	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	Female athymic BALB/c nude mice (4-week-old) were provided (SLAC Laboratory Animal Co. Ltd.). The animals were raised in a pathogen-free animal laboratory and randomly divided into the control or experimental group (six mice in each group).

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	In glioma, hsa_circ_0072083 could regulate Homeobox protein NANOG (NANOG) and ALKBH5 via targeting miR-1252-5p to control temozolomide resistance. circ_0072083 silence reduced NANOG expression via blocking ALKBH5-mediated demethylation.
Responsed Disease	Glioma [ICD-11: 2A00.0]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Temozolomide		Approved	Drug Info
Cell Process	Cellular Processes
	Cell growth and death
	Cell apoptosis
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	U251 (Fibroblasts or fibroblast like cells)
	U87 (A primary glioblastoma cell line)
In-vivo Model	U251/TR cells (2 × 10⁶ per mouse) with stable transfection of sh-circ_0072083 or sh-NC were subcutaneously injected into mice.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	In breast cancer, ZNF217 could upregulate Homeobox protein NANOG (NANOG) by reducing N6-methyladenosine levels via methyltransferase-like 13 (METTL3).
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition initiation
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	Homeobox protein NANOG (NANOG) activity does not merely compensate for reduced O2 levels but significantly increases ALKBH5, JMJD2C, and TET1 activity in hypoxic breast cancer cells, leading to transcriptional and posttranscriptional changes in gene expression that promote the specification and/or maintenance of BCSCs. ALKBH5 overexpression decreased Homeobox protein NANOG (NANOG) mRNA methylation, increased NANOG levels, and increased the percentage of BCSCs,.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Signaling pathways regulating pluripotency of stem cells (hsa04550)
In-vitro Model	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-435	Amelanotic melanoma	Homo sapiens	CVCL_0417
	SUM-149 (Human breast cancer cell SUM149)
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	ZR75.1 A3	Invasive breast carcinoma	Homo sapiens	CVCL_YX82
In-vivo Model	A total of 1,000 breast cancer cells were injected into the mammary fat pad of 6-8-wk-old female NSG mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS solution. At 10 wk after injection, mice were examined for the presence of tumors, which were harvested for analysis.
Experiment 3 Reporting the m6A-centered Disease Response				[5]
Response Summary	ALKBH5 knockdown in MDA-MB-231 breast cancer cells significantly decreased metastasis from breast to lungs in immunodeficient mice. ALKBH5-mediated demethylation of N6-methyladenosine (m6A) in Homeobox protein NANOG (NANOG) mRNA leading to increased expression of NANOG.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Biological regulation
Cell Process	HIF-1 signaling pathway (hsa04066)
In-vitro Model	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	SUM-149 (Human breast cancer cell SUM149)
	SUM-159 (A mesenchymal triple-negative breast cancer cell line)
	T-47D	Invasive breast carcinoma	Homo sapiens	CVCL_0553
	ZR75.1 A3	Invasive breast carcinoma	Homo sapiens	CVCL_YX82
In-vivo Model	1,000 MDA-MB-231 subclone cells were injected into the mammary fat pad of randomly chosen 6-to-8 week-old female severe combined immunodeficiency (SCID) mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS (n = 7 mice per subclone).

Ovarian cancer [ICD-11: 2C73]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	Homeobox protein NANOG (NANOG) served as a target in ALKBH5-mediated m6A modification in ovarian cancer.
Responsed Disease	Ovarian cancer [ICD-11: 2C73]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell invasion
In-vitro Model	HEY	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0297
	HO-8910	Endocervical adenocarcinoma	Homo sapiens	CVCL_6868
	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	Female athymic BALB/c nude mice (4-week-old) were provided (SLAC Laboratory Animal Co. Ltd.). The animals were raised in a pathogen-free animal laboratory and randomly divided into the control or experimental group (six mice in each group).

Temozolomide [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[3]
Response Summary	In glioma, hsa_circ_0072083 could regulate Homeobox protein NANOG (NANOG) and ALKBH5 via targeting miR-1252-5p to control temozolomide resistance. circ_0072083 silence reduced NANOG expression via blocking ALKBH5-mediated demethylation.
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Glioma		ICD-11: 2A00.0	Disease Info
Cell Process	Cellular Processes
	Cell growth and death
	Cell apoptosis
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	U251 (Fibroblasts or fibroblast like cells)
	U87 (A primary glioblastoma cell line)
In-vivo Model	U251/TR cells (2 × 10⁶ per mouse) with stable transfection of sh-circ_0072083 or sh-NC were subcutaneously injected into mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05351		Crosstalk Info
Epigenetic Regulator	MiR-135 family
Regulated Target	Zinc finger protein 217 (ZNF217)
Crosstalk relationship	ncRNA → m6A
Disease	Breast cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00344)

Homeobox protein NANOG (NANOG)

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE010628		Click to Show/Hide the Full List
mod site	chr12:7789413-7789414:+		[8]
Sequence	CCTTCATTATAAATCTAGAGACTCCAGGATTTTAACGTTCT
Motif Score	3.319380952
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9; ENST00000541267.5
External Link	RMBase: m6A_site_176019
mod ID: M6ASITE010629		Click to Show/Hide the Full List
mod site	chr12:7789439-7789440:+		[8]
Sequence	GGATTTTAACGTTCTGCTGGACTGAGCTGGTTGCCTCATGT
Motif Score	4.065041667
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000526434.2; ENST00000229307.9; ENST00000541267.5
External Link	RMBase: m6A_site_176020
mod ID: M6ASITE010630		Click to Show/Hide the Full List
mod site	chr12:7789528-7789529:+		[9]
Sequence	CTGGAGGTCCTATTTCTCTAACATCTTCCAGAAAAGTCTTA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000229307.9; ENST00000526434.2; ENST00000541267.5
External Link	RMBase: m6A_site_176021
mod ID: M6ASITE010631		Click to Show/Hide the Full List
mod site	chr12:7789612-7789613:+		[9]
Sequence	CCTCCTCTTCCTCTATACTAACATGAGTGTGGATCCAGCTT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000541267.5; ENST00000526434.2; ENST00000229307.9
External Link	RMBase: m6A_site_176022
mod ID: M6ASITE010632		Click to Show/Hide the Full List
mod site	chr12:7789753-7789754:+		[9]
Sequence	GTCTTCTGCTGAGATGCCTCACACGGAGACTGGTAAGAAAG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000526286.1; ENST00000526434.2; ENST00000541267.5; ENST00000229307.9
External Link	RMBase: m6A_site_176023
mod ID: M6ASITE010633		Click to Show/Hide the Full List
mod site	chr12:7795014-7795015:+		[8]
Sequence	GCCTTAATGTAATACAGCAGACCACTAGGTATTTTAGTACT
Motif Score	2.876744048
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9; ENST00000526286.1
External Link	RMBase: m6A_site_176024
mod ID: M6ASITE010634		Click to Show/Hide the Full List
mod site	chr12:7795041-7795042:+		[8]
Sequence	GGTATTTTAGTACTCCACAAACCATGGATTTATTCCTAAAC
Motif Score	2.185083333
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9; ENST00000526286.1
External Link	RMBase: m6A_site_176025
mod ID: M6ASITE010635		Click to Show/Hide the Full List
mod site	chr12:7795060-7795061:+		[8]
Sequence	AACCATGGATTTATTCCTAAACTACTCCATGAACATGCAAC
Motif Score	2.627720238
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9; ENST00000526286.1
External Link	RMBase: m6A_site_176026
mod ID: M6ASITE010636		Click to Show/Hide the Full List
mod site	chr12:7795072-7795073:+		[9]
Sequence	ATTCCTAAACTACTCCATGAACATGCAACCTGAAGACGTGT
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; fibroblasts
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000526286.1; ENST00000229307.9
External Link	RMBase: m6A_site_176027
mod ID: M6ASITE010637		Click to Show/Hide the Full List
mod site	chr12:7795106-7795107:+		[8]
Sequence	GACGTGTGAAGATGAGTGAAACTGATATTACTCAATTTCAG
Motif Score	2.627720238
Cell/Tissue List	hESCs; fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9
External Link	RMBase: m6A_site_176028
mod ID: M6ASITE010638		Click to Show/Hide the Full List
mod site	chr12:7795132-7795133:+		[9]
Sequence	ATTACTCAATTTCAGTCTGGACACTGGCTGAATCCTTCCTC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; hESCs; fibroblasts
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000229307.9
External Link	RMBase: m6A_site_176029
mod ID: M6ASITE010639		Click to Show/Hide the Full List
mod site	chr12:7795194-7795195:+		[8]
Sequence	AGGATTTTTCTTGTTTGGAAACCACGTGTTCTGGTTTCCAT
Motif Score	2.185083333
Cell/Tissue List	hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9
External Link	RMBase: m6A_site_176030
mod ID: M6ASITE010640		Click to Show/Hide the Full List
mod site	chr12:7795629-7795630:+		[8]
Sequence	CCGCGCCCTGCCTAGAAAAGACATTTTAATAACCTTGGCTG
Motif Score	2.897386905
Cell/Tissue List	hESCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000229307.9
External Link	RMBase: m6A_site_176031
mod ID: M6ASITE010641		Click to Show/Hide the Full List
mod site	chr12:7795732-7795733:+		[9]
Sequence	TAACCTCAAGAATAAGAAATACAAGTACAAATTGGTGATGA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000229307.9
External Link	RMBase: m6A_site_176032

Ref 1	MicroRNA-135 inhibits initiation of epithelial-mesenchymal transition in breast cancer by targeting ZNF217 and promoting m6A modification of NANOG. Oncogene. 2022 Mar;41(12):1742-1751. doi: 10.1038/s41388-022-02211-2. Epub 2022 Feb 4.
Ref 2	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 3	Warburg effect-promoted exosomal circ_0072083 releasing up-regulates NANGO expression through multiple pathways and enhances temozolomide resistance in glioma. J Exp Clin Cancer Res. 2021 May 11;40(1):164. doi: 10.1186/s13046-021-01942-6.
Ref 4	Hypoxia induces the breast cancer stem cell phenotype by HIF-dependent and ALKBH5-mediated m?A-demethylation of NANOG mRNA. Proc Natl Acad Sci U S A. 2016 Apr 5;113(14):E2047-56. doi: 10.1073/pnas.1602883113. Epub 2016 Mar 21.
Ref 5	Hypoxia-inducible factors regulate pluripotency factor expression by ZNF217- and ALKBH5-mediated modulation of RNA methylation in breast cancer cells. Oncotarget. 2016 Oct 4;7(40):64527-64542. doi: 10.18632/oncotarget.11743.
Ref 6	RNA demethylase ALKBH5 promotes ovarian carcinogenesis in a simulated tumour microenvironment through stimulating NF-KappaB pathway. J Cell Mol Med. 2020 Jun;24(11):6137-6148. doi: 10.1111/jcmm.15228. Epub 2020 Apr 24.
Ref 7	P-glycoprotein Mediates Ceritinib Resistance in Anaplastic Lymphoma Kinase-rearranged Non-small Cell Lung Cancer. EBioMedicine. 2015 Dec 12;3:54-66. doi: 10.1016/j.ebiom.2015.12.009. eCollection 2016 Jan.
Ref 8	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map