m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00344)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NANOG
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Soma | Mus musculus |
|
Treatment: Mettl3-/- soma
Control: Wild type soma
|
GSE171199 | |
| Regulation |
![]() ![]() |
logFC: 2.74E+00 p-value: 4.57E-02 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | In breast cancer, ZNF217 could upregulate Homeobox protein NANOG (NANOG) by reducing N6-methyladenosine levels via methyltransferase-like 13 (METTL3). | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Cell Process | Cell migration | |||
| Cell invasion | ||||
| Epithelial-mesenchymal transition initiation | ||||
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| In total 4 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [3] | |||
| Response Summary | In glioma, hsa_circ_0072083 could regulate Homeobox protein NANOG (NANOG) and ALKBH5 via targeting miR-1252-5p to control temozolomide resistance. circ_0072083 silence reduced NANOG expression via blocking ALKBH5-mediated demethylation. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Glioma | ICD-11: 2A00.0 | ||
| Responsed Drug | Temozolomide | Approved | ||
| Cell Process | Cellular Processes | |||
| Cell growth and death | ||||
| Cell apoptosis | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| U251 (Fibroblasts or fibroblast like cells) | ||||
| U87 (A primary glioblastoma cell line) | ||||
| In-vivo Model | U251/TR cells (2 × 106 per mouse) with stable transfection of sh-circ_0072083 or sh-NC were subcutaneously injected into mice. | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [4] | |||
| Response Summary | Homeobox protein NANOG (NANOG) activity does not merely compensate for reduced O2 levels but significantly increases ALKBH5, JMJD2C, and TET1 activity in hypoxic breast cancer cells, leading to transcriptional and posttranscriptional changes in gene expression that promote the specification and/or maintenance of BCSCs. ALKBH5 overexpression decreased Homeobox protein NANOG (NANOG) mRNA methylation, increased NANOG levels, and increased the percentage of BCSCs,. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | HIF-1 signaling pathway | hsa04066 | ||
| Cell Process | Signaling pathways regulating pluripotency of stem cells (hsa04550) | |||
| In-vitro Model | BT-474 | Invasive breast carcinoma | Homo sapiens | CVCL_0179 |
| HCC1954 | Breast ductal carcinoma | Homo sapiens | CVCL_1259 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-435 | Amelanotic melanoma | Homo sapiens | CVCL_0417 | |
| SUM-149 (Human breast cancer cell SUM149) | ||||
| SUM-159 (A mesenchymal triple-negative breast cancer cell line) | ||||
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
| ZR75.1 A3 | Invasive breast carcinoma | Homo sapiens | CVCL_YX82 | |
| In-vivo Model | A total of 1,000 breast cancer cells were injected into the mammary fat pad of 6-8-wk-old female NSG mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS solution. At 10 wk after injection, mice were examined for the presence of tumors, which were harvested for analysis. | |||
| Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene | [5] | |||
| Response Summary | ALKBH5 knockdown in MDA-MB-231 breast cancer cells significantly decreased metastasis from breast to lungs in immunodeficient mice. ALKBH5-mediated demethylation of N6-methyladenosine (m6A) in Homeobox protein NANOG (NANOG) mRNA leading to increased expression of NANOG. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Cell Process | Biological regulation | |||
| HIF-1 signaling pathway (hsa04066) | ||||
| In-vitro Model | HCC1954 | Breast ductal carcinoma | Homo sapiens | CVCL_1259 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| SUM-149 (Human breast cancer cell SUM149) | ||||
| SUM-159 (A mesenchymal triple-negative breast cancer cell line) | ||||
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
| ZR75.1 A3 | Invasive breast carcinoma | Homo sapiens | CVCL_YX82 | |
| In-vivo Model | 1,000 MDA-MB-231 subclone cells were injected into the mammary fat pad of randomly chosen 6-to-8 week-old female severe combined immunodeficiency (SCID) mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS (n = 7 mice per subclone). | |||
| Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene | [6] | |||
| Response Summary | Homeobox protein NANOG (NANOG) served as a target in ALKBH5-mediated m6A modification in ovarian cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Ovarian cancer | ICD-11: 2C73 | ||
| Cell Process | Cell invasion | |||
| In-vitro Model | HEY | Ovarian serous adenocarcinoma | Homo sapiens | CVCL_0297 |
| HO-8910 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6868 | |
| OVCAR-3 | Ovarian serous adenocarcinoma | Homo sapiens | CVCL_0465 | |
| SK-OV-3 | Ovarian serous cystadenocarcinoma | Homo sapiens | CVCL_0532 | |
| In-vivo Model | Female athymic BALB/c nude mice (4-week-old) were provided (SLAC Laboratory Animal Co. Ltd.). The animals were raised in a pathogen-free animal laboratory and randomly divided into the control or experimental group (six mice in each group). | |||
Brain cancer [ICD-11: 2A00]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [3] | |||
| Response Summary | In glioma, hsa_circ_0072083 could regulate Homeobox protein NANOG (NANOG) and ALKBH5 via targeting miR-1252-5p to control temozolomide resistance. circ_0072083 silence reduced NANOG expression via blocking ALKBH5-mediated demethylation. | |||
| Responsed Disease | Glioma [ICD-11: 2A00.0] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Temozolomide | Approved | ||
| Cell Process | Cellular Processes | |||
| Cell growth and death | ||||
| Cell apoptosis | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| U251 (Fibroblasts or fibroblast like cells) | ||||
| U87 (A primary glioblastoma cell line) | ||||
| In-vivo Model | U251/TR cells (2 × 106 per mouse) with stable transfection of sh-circ_0072083 or sh-NC were subcutaneously injected into mice. | |||
Breast cancer [ICD-11: 2C60]
| In total 3 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | In breast cancer, ZNF217 could upregulate Homeobox protein NANOG (NANOG) by reducing N6-methyladenosine levels via methyltransferase-like 13 (METTL3). | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell migration | |||
| Cell invasion | ||||
| Epithelial-mesenchymal transition initiation | ||||
| Experiment 2 Reporting the m6A-centered Disease Response | [4] | |||
| Response Summary | Homeobox protein NANOG (NANOG) activity does not merely compensate for reduced O2 levels but significantly increases ALKBH5, JMJD2C, and TET1 activity in hypoxic breast cancer cells, leading to transcriptional and posttranscriptional changes in gene expression that promote the specification and/or maintenance of BCSCs. ALKBH5 overexpression decreased Homeobox protein NANOG (NANOG) mRNA methylation, increased NANOG levels, and increased the percentage of BCSCs,. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | HIF-1 signaling pathway | hsa04066 | ||
| Cell Process | Signaling pathways regulating pluripotency of stem cells (hsa04550) | |||
| In-vitro Model | BT-474 | Invasive breast carcinoma | Homo sapiens | CVCL_0179 |
| HCC1954 | Breast ductal carcinoma | Homo sapiens | CVCL_1259 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-435 | Amelanotic melanoma | Homo sapiens | CVCL_0417 | |
| SUM-149 (Human breast cancer cell SUM149) | ||||
| SUM-159 (A mesenchymal triple-negative breast cancer cell line) | ||||
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
| ZR75.1 A3 | Invasive breast carcinoma | Homo sapiens | CVCL_YX82 | |
| In-vivo Model | A total of 1,000 breast cancer cells were injected into the mammary fat pad of 6-8-wk-old female NSG mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS solution. At 10 wk after injection, mice were examined for the presence of tumors, which were harvested for analysis. | |||
| Experiment 3 Reporting the m6A-centered Disease Response | [5] | |||
| Response Summary | ALKBH5 knockdown in MDA-MB-231 breast cancer cells significantly decreased metastasis from breast to lungs in immunodeficient mice. ALKBH5-mediated demethylation of N6-methyladenosine (m6A) in Homeobox protein NANOG (NANOG) mRNA leading to increased expression of NANOG. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Biological regulation | |||
| HIF-1 signaling pathway (hsa04066) | ||||
| In-vitro Model | HCC1954 | Breast ductal carcinoma | Homo sapiens | CVCL_1259 |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| SUM-149 (Human breast cancer cell SUM149) | ||||
| SUM-159 (A mesenchymal triple-negative breast cancer cell line) | ||||
| T-47D | Invasive breast carcinoma | Homo sapiens | CVCL_0553 | |
| ZR75.1 A3 | Invasive breast carcinoma | Homo sapiens | CVCL_YX82 | |
| In-vivo Model | 1,000 MDA-MB-231 subclone cells were injected into the mammary fat pad of randomly chosen 6-to-8 week-old female severe combined immunodeficiency (SCID) mice in a 1:1 suspension of Matrigel (BD Biosciences) in PBS (n = 7 mice per subclone). | |||
Ovarian cancer [ICD-11: 2C73]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [6] | |||
| Response Summary | Homeobox protein NANOG (NANOG) served as a target in ALKBH5-mediated m6A modification in ovarian cancer. | |||
| Responsed Disease | Ovarian cancer [ICD-11: 2C73] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell invasion | |||
| In-vitro Model | HEY | Ovarian serous adenocarcinoma | Homo sapiens | CVCL_0297 |
| HO-8910 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6868 | |
| OVCAR-3 | Ovarian serous adenocarcinoma | Homo sapiens | CVCL_0465 | |
| SK-OV-3 | Ovarian serous cystadenocarcinoma | Homo sapiens | CVCL_0532 | |
| In-vivo Model | Female athymic BALB/c nude mice (4-week-old) were provided (SLAC Laboratory Animal Co. Ltd.). The animals were raised in a pathogen-free animal laboratory and randomly divided into the control or experimental group (six mice in each group). | |||
Temozolomide
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [3] | |||
| Response Summary | In glioma, hsa_circ_0072083 could regulate Homeobox protein NANOG (NANOG) and ALKBH5 via targeting miR-1252-5p to control temozolomide resistance. circ_0072083 silence reduced NANOG expression via blocking ALKBH5-mediated demethylation. | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Glioma | ICD-11: 2A00.0 | ||
| Cell Process | Cellular Processes | |||
| Cell growth and death | ||||
| Cell apoptosis | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| U251 (Fibroblasts or fibroblast like cells) | ||||
| U87 (A primary glioblastoma cell line) | ||||
| In-vivo Model | U251/TR cells (2 × 106 per mouse) with stable transfection of sh-circ_0072083 or sh-NC were subcutaneously injected into mice. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05351 | ||
| Epigenetic Regulator | MiR-135 family | |
| Regulated Target | Zinc finger protein 217 (ZNF217) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00344)
| In total 14 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE010628 | Click to Show/Hide the Full List | ||
| mod site | chr12:7789413-7789414:+ | [8] | |
| Sequence | CCTTCATTATAAATCTAGAGACTCCAGGATTTTAACGTTCT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9; ENST00000541267.5 | ||
| External Link | RMBase: m6A_site_176019 | ||
| mod ID: M6ASITE010629 | Click to Show/Hide the Full List | ||
| mod site | chr12:7789439-7789440:+ | [8] | |
| Sequence | GGATTTTAACGTTCTGCTGGACTGAGCTGGTTGCCTCATGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000526434.2; ENST00000229307.9; ENST00000541267.5 | ||
| External Link | RMBase: m6A_site_176020 | ||
| mod ID: M6ASITE010630 | Click to Show/Hide the Full List | ||
| mod site | chr12:7789528-7789529:+ | [9] | |
| Sequence | CTGGAGGTCCTATTTCTCTAACATCTTCCAGAAAAGTCTTA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000229307.9; ENST00000526434.2; ENST00000541267.5 | ||
| External Link | RMBase: m6A_site_176021 | ||
| mod ID: M6ASITE010631 | Click to Show/Hide the Full List | ||
| mod site | chr12:7789612-7789613:+ | [9] | |
| Sequence | CCTCCTCTTCCTCTATACTAACATGAGTGTGGATCCAGCTT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000541267.5; ENST00000526434.2; ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176022 | ||
| mod ID: M6ASITE010632 | Click to Show/Hide the Full List | ||
| mod site | chr12:7789753-7789754:+ | [9] | |
| Sequence | GTCTTCTGCTGAGATGCCTCACACGGAGACTGGTAAGAAAG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000526286.1; ENST00000526434.2; ENST00000541267.5; ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176023 | ||
| mod ID: M6ASITE010633 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795014-7795015:+ | [8] | |
| Sequence | GCCTTAATGTAATACAGCAGACCACTAGGTATTTTAGTACT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9; ENST00000526286.1 | ||
| External Link | RMBase: m6A_site_176024 | ||
| mod ID: M6ASITE010634 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795041-7795042:+ | [8] | |
| Sequence | GGTATTTTAGTACTCCACAAACCATGGATTTATTCCTAAAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9; ENST00000526286.1 | ||
| External Link | RMBase: m6A_site_176025 | ||
| mod ID: M6ASITE010635 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795060-7795061:+ | [8] | |
| Sequence | AACCATGGATTTATTCCTAAACTACTCCATGAACATGCAAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9; ENST00000526286.1 | ||
| External Link | RMBase: m6A_site_176026 | ||
| mod ID: M6ASITE010636 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795072-7795073:+ | [9] | |
| Sequence | ATTCCTAAACTACTCCATGAACATGCAACCTGAAGACGTGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T; fibroblasts | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000526286.1; ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176027 | ||
| mod ID: M6ASITE010637 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795106-7795107:+ | [8] | |
| Sequence | GACGTGTGAAGATGAGTGAAACTGATATTACTCAATTTCAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hESCs; fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176028 | ||
| mod ID: M6ASITE010638 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795132-7795133:+ | [9] | |
| Sequence | ATTACTCAATTTCAGTCTGGACACTGGCTGAATCCTTCCTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T; hESCs; fibroblasts | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176029 | ||
| mod ID: M6ASITE010639 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795194-7795195:+ | [8] | |
| Sequence | AGGATTTTTCTTGTTTGGAAACCACGTGTTCTGGTTTCCAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hESCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176030 | ||
| mod ID: M6ASITE010640 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795629-7795630:+ | [8] | |
| Sequence | CCGCGCCCTGCCTAGAAAAGACATTTTAATAACCTTGGCTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176031 | ||
| mod ID: M6ASITE010641 | Click to Show/Hide the Full List | ||
| mod site | chr12:7795732-7795733:+ | [9] | |
| Sequence | TAACCTCAAGAATAAGAAATACAAGTACAAATTGGTGATGA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000229307.9 | ||
| External Link | RMBase: m6A_site_176032 | ||
References

