m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00338)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
RUNX1T1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | FTO-dependent m6A demethylation functions as a novel regulatory mechanism of RNA processing and plays a critical role in the regulation of adipogenesis and obesity. FTO-dependent regulatory role of m6A and SRSF2 in mRNA splicing and adipocyte differentiation. FTO controls exonic splicing of adipogenic regulatory factor Protein CBFA2T1 (RUNX1T1) by regulating m6A levels around splice sites and thereby modulates differentiation. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Cell Process | Adipogenesis | |||
| Spliceosome (hsa03040) | ||||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
Obesity [ICD-11: 5B81]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | FTO-dependent m6A demethylation functions as a novel regulatory mechanism of RNA processing and plays a critical role in the regulation of adipogenesis and obesity. FTO-dependent regulatory role of m6A and SRSF2 in mRNA splicing and adipocyte differentiation. FTO controls exonic splicing of adipogenic regulatory factor Protein CBFA2T1 (RUNX1T1) by regulating m6A levels around splice sites and thereby modulates differentiation. | |||
| Responsed Disease | Obesity [ICD-11: 5B81] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Down regulation | |||
| Cell Process | Adipogenesis | |||
| Spliceosome (hsa03040) | ||||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00338)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE002673 | Click to Show/Hide the Full List | ||
| mod site | chr8:91994547-91994548:- | [2] | |
| Sequence | GTCATGGAAGAGCCAGGACTAGATCTCAGGTCTCTTGATTC | ||
| Transcript ID List | ENST00000520047.1; ENST00000520724.5; ENST00000614812.4; ENST00000613302.4; ENST00000396218.5; ENST00000520978.5; ENST00000615601.4; ENST00000422361.6; ENST00000436581.6; ENST00000360348.6; ENST00000518361.1; ENST00000265814.4; ENST00000518844.5; ENST00000613886.4; ENST00000523629.5; ENST00000617740.4 | ||
| External Link | RMBase: RNA-editing_site_131892 | ||
N6-methyladenosine (m6A)
| In total 29 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE085825 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959655-91959656:- | [3] | |
| Sequence | GTGCAGCAGATTGGAAGGAGACACAGATGTTCGGTTTTTTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000265814.4; ENST00000615601.4; ENST00000613302.4; ENST00000614812.4; ENST00000396218.5; ENST00000436581.6; ENST00000613886.4; ENST00000523629.5; ENST00000617740.4 | ||
| External Link | RMBase: m6A_site_802973 | ||
| mod ID: M6ASITE085826 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959697-91959698:- | [3] | |
| Sequence | TTGCTAACTGAACTTTGAAGACCCGCTACAAAACGCGCAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000617740.4; ENST00000615601.4; ENST00000436581.6; ENST00000613886.4; ENST00000265814.4; ENST00000523629.5; ENST00000396218.5; ENST00000613302.4; ENST00000614812.4 | ||
| External Link | RMBase: m6A_site_802974 | ||
| mod ID: M6ASITE085827 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959706-91959707:- | [3] | |
| Sequence | GTCCGTGGGTTGCTAACTGAACTTTGAAGACCCGCTACAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000617740.4; ENST00000613302.4; ENST00000396218.5; ENST00000523629.5; ENST00000265814.4; ENST00000614812.4; ENST00000613886.4; ENST00000436581.6; ENST00000615601.4 | ||
| External Link | RMBase: m6A_site_802975 | ||
| mod ID: M6ASITE085828 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959751-91959752:- | [3] | |
| Sequence | AGCATTGGATACAGCAGTAGACATTTTAACAAGAAGATGAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000613302.4; ENST00000265814.4; ENST00000436581.6; ENST00000613886.4; ENST00000615601.4; ENST00000396218.5; ENST00000523629.5; ENST00000614812.4; ENST00000617740.4 | ||
| External Link | RMBase: m6A_site_802976 | ||
| mod ID: M6ASITE085829 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959786-91959787:- | [3] | |
| Sequence | GAAAAAAAAAAAAGAGGAAAACCCTCAAGGGCATGAGCATT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000614812.4; ENST00000265814.4; ENST00000436581.6; ENST00000617740.4; ENST00000615601.4; ENST00000613886.4; ENST00000360348.6; ENST00000396218.5; ENST00000523629.5; ENST00000613302.4 | ||
| External Link | RMBase: m6A_site_802977 | ||
| mod ID: M6ASITE085830 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959883-91959884:- | [3] | |
| Sequence | GATGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; hNPCs; fibroblasts; HEK293A-TOA; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000613302.4; ENST00000360348.6; ENST00000396218.5; ENST00000523629.5; ENST00000265814.4; ENST00000615601.4; ENST00000613886.4; ENST00000614812.4; ENST00000617740.4; ENST00000422361.6; ENST00000436581.6 | ||
| External Link | RMBase: m6A_site_802978 | ||
| mod ID: M6ASITE085831 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959890-91959891:- | [3] | |
| Sequence | ATTAACCGATGCTTTACCAAACAGCAAACCAAGAGATTGCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hNPCs; fibroblasts; HEK293A-TOA; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000396218.5; ENST00000615601.4; ENST00000613302.4; ENST00000360348.6; ENST00000265814.4; ENST00000613886.4; ENST00000617740.4; ENST00000614812.4; ENST00000436581.6; ENST00000422361.6; ENST00000523629.5 | ||
| External Link | RMBase: m6A_site_802979 | ||
| mod ID: M6ASITE085832 | Click to Show/Hide the Full List | ||
| mod site | chr8:91959923-91959924:- | [3] | |
| Sequence | TCAAGTAGCTGGGATTTTAAACTAGATGACCTCATTAACCG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000360348.6; ENST00000613302.4; ENST00000422361.6; ENST00000436581.6; ENST00000523629.5; ENST00000615601.4; ENST00000617740.4; ENST00000396218.5; ENST00000265814.4; ENST00000614812.4; ENST00000613886.4 | ||
| External Link | RMBase: m6A_site_802980 | ||
| mod ID: M6ASITE085833 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960004-91960005:- | [3] | |
| Sequence | AGATATCTTTTCTTTAGAGAACTGAAAAGAGAGCAGAGAAT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436581.6; ENST00000523629.5; ENST00000615601.4; ENST00000614812.4; ENST00000265814.4; ENST00000422361.6; ENST00000360348.6; ENST00000396218.5; ENST00000613886.4; ENST00000613302.4; ENST00000617740.4 | ||
| External Link | RMBase: m6A_site_802981 | ||
| mod ID: M6ASITE085834 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960071-91960072:- | [3] | |
| Sequence | TATCTTGAGGTGGTAGTAAAACACAGAGGGCCAGTAACGGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000396218.5; ENST00000422361.6; ENST00000615601.4; ENST00000614812.4; ENST00000613302.4; ENST00000617740.4; ENST00000436581.6; ENST00000265814.4; ENST00000360348.6; ENST00000613886.4; ENST00000523629.5 | ||
| External Link | RMBase: m6A_site_802982 | ||
| mod ID: M6ASITE085835 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960100-91960101:- | [3] | |
| Sequence | CAGTACTTCAGCAAGAGAGAACCTAACTGTATCTTGAGGTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000422361.6; ENST00000265814.4; ENST00000523629.5; ENST00000614812.4; ENST00000436581.6; ENST00000617740.4; ENST00000613886.4; ENST00000615601.4; ENST00000360348.6; ENST00000396218.5; ENST00000613302.4 | ||
| External Link | RMBase: m6A_site_802983 | ||
| mod ID: M6ASITE085836 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960193-91960194:- | [3] | |
| Sequence | GACAACACAACCAACGCGAAACCAATTCCTCATCCTCAGAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000617740.4; ENST00000523629.5; ENST00000615601.4; ENST00000436581.6; ENST00000613302.4; ENST00000360348.6; ENST00000422361.6; ENST00000396218.5; ENST00000265814.4; ENST00000520724.5; ENST00000614812.4; ENST00000613886.4 | ||
| External Link | RMBase: m6A_site_802984 | ||
| mod ID: M6ASITE085837 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960212-91960213:- | [3] | |
| Sequence | TCAGAACTGTCGGAGGAAAGACAACACAACCAACGCGAAAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000617740.4; ENST00000436581.6; ENST00000615601.4; ENST00000422361.6; ENST00000396218.5; ENST00000613302.4; ENST00000523629.5; ENST00000613886.4; ENST00000360348.6; ENST00000520724.5; ENST00000614812.4; ENST00000265814.4 | ||
| External Link | RMBase: m6A_site_802985 | ||
| mod ID: M6ASITE085838 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960227-91960228:- | [3] | |
| Sequence | TCGCTAGACGTGAACTCAGAACTGTCGGAGGAAAGACAACA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000520724.5; ENST00000523629.5; ENST00000436581.6; ENST00000265814.4; ENST00000360348.6; ENST00000396218.5; ENST00000613302.4; ENST00000614812.4; ENST00000613886.4; ENST00000615601.4; ENST00000422361.6; ENST00000617740.4 | ||
| External Link | RMBase: m6A_site_802986 | ||
| mod ID: M6ASITE085839 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960234-91960235:- | [3] | |
| Sequence | CAACCCCTCGCTAGACGTGAACTCAGAACTGTCGGAGGAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000520724.5; ENST00000436581.6; ENST00000613302.4; ENST00000523629.5; ENST00000614812.4; ENST00000265814.4; ENST00000422361.6; ENST00000613886.4; ENST00000615601.4; ENST00000360348.6; ENST00000396218.5; ENST00000617740.4 | ||
| External Link | RMBase: m6A_site_802987 | ||
| mod ID: M6ASITE085840 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960255-91960256:- | [3] | |
| Sequence | GAACCCCTTCCACCATAGAGACAACCCCTCGCTAGACGTGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; Brain; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000360348.6; ENST00000521078.1; ENST00000422361.6; ENST00000520724.5; ENST00000518844.5; ENST00000523629.5; ENST00000613886.4; ENST00000436581.6; ENST00000613302.4; ENST00000396218.5; ENST00000617740.4; ENST00000265814.4; ENST00000615601.4; ENST00000614812.4 | ||
| External Link | RMBase: m6A_site_802988 | ||
| mod ID: M6ASITE085841 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960273-91960274:- | [3] | |
| Sequence | CGAGGTCAACCACCCCGGGAACCCCTTCCACCATAGAGACA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; Brain; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000396218.5; ENST00000613886.4; ENST00000436581.6; ENST00000521078.1; ENST00000518844.5; ENST00000523629.5; ENST00000265814.4; ENST00000613302.4; ENST00000360348.6; ENST00000422361.6; ENST00000615601.4; ENST00000520724.5; ENST00000617740.4; ENST00000614812.4 | ||
| External Link | RMBase: m6A_site_802989 | ||
| mod ID: M6ASITE085842 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960314-91960315:- | [3] | |
| Sequence | CGGGGCTGGGAGCCCGATGGACACACCACCAGCAGCCACTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; Brain; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436581.6; ENST00000265814.4; ENST00000396218.5; ENST00000617740.4; ENST00000613886.4; ENST00000523629.5; ENST00000613302.4; ENST00000518844.5; ENST00000422361.6; ENST00000615601.4; ENST00000521078.1; ENST00000360348.6; ENST00000614812.4; ENST00000520724.5 | ||
| External Link | RMBase: m6A_site_802990 | ||
| mod ID: M6ASITE085843 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960371-91960372:- | [3] | |
| Sequence | GCAGGCCCAGCAGCAGGGAGACACACCTGCAGTCAGCTCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; Brain; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436581.6; ENST00000360348.6; ENST00000422361.6; ENST00000396218.5; ENST00000613886.4; ENST00000614812.4; ENST00000265814.4; ENST00000617740.4; ENST00000615601.4; ENST00000523629.5; ENST00000518844.5; ENST00000520724.5; ENST00000613302.4; ENST00000521078.1 | ||
| External Link | RMBase: m6A_site_802991 | ||
| mod ID: M6ASITE085844 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960400-91960401:- | [3] | |
| Sequence | AAGCACCATCACATCTGTGGACAGACCCTGCAGGCCCAGCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; Brain; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000396218.5; ENST00000614812.4; ENST00000436581.6; ENST00000615601.4; ENST00000422361.6; ENST00000613302.4; ENST00000360348.6; ENST00000617740.4; ENST00000613886.4; ENST00000523629.5; ENST00000521078.1; ENST00000518844.5; ENST00000265814.4; ENST00000520724.5 | ||
| External Link | RMBase: m6A_site_802992 | ||
| mod ID: M6ASITE085845 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960428-91960429:- | [3] | |
| Sequence | CTCATTTTGCCAGCACAAAGACTGGGAGAAGCACCATCACA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T; Brain; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000265814.4; ENST00000613886.4; ENST00000520724.5; ENST00000523629.5; ENST00000614812.4; ENST00000360348.6; ENST00000422361.6; ENST00000615601.4; ENST00000396218.5; ENST00000518844.5; ENST00000436581.6; ENST00000521078.1; ENST00000617740.4; ENST00000613302.4 | ||
| External Link | RMBase: m6A_site_802993 | ||
| mod ID: M6ASITE085846 | Click to Show/Hide the Full List | ||
| mod site | chr8:91960483-91960484:- | [3] | |
| Sequence | GTGGCCGTAAAGCGAGTGAAACCTGCAGTGGCTGTAACACA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000523629.5; ENST00000360348.6; ENST00000521751.5; ENST00000614812.4; ENST00000613886.4; ENST00000617740.4; ENST00000436581.6; ENST00000265814.4; ENST00000520724.5; ENST00000518844.5; ENST00000521078.1; ENST00000396218.5; ENST00000615601.4; ENST00000422361.6; ENST00000613302.4 | ||
| External Link | RMBase: m6A_site_802994 | ||
| mod ID: M6ASITE085847 | Click to Show/Hide the Full List | ||
| mod site | chr8:91986935-91986936:- | [4] | |
| Sequence | TCAAGAAGAAATGATTGATCACAGACTAACAGACAGAGAAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000520978.5; ENST00000521751.5; ENST00000422361.6; ENST00000436581.6; ENST00000518361.1; ENST00000523629.5; ENST00000265814.4; ENST00000615601.4; ENST00000617740.4; ENST00000613302.4; ENST00000614812.4; ENST00000360348.6; ENST00000613886.4; ENST00000396218.5; ENST00000520724.5; ENST00000518844.5 | ||
| External Link | RMBase: m6A_site_802995 | ||
| mod ID: M6ASITE085848 | Click to Show/Hide the Full List | ||
| mod site | chr8:91991649-91991650:- | ||
| Sequence | CAGGGACCTCAGGGACAGAAACAGACCTATGGGTAAGACTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000520724.5; ENST00000396218.5; ENST00000614812.4; ENST00000518844.5; ENST00000613886.4; ENST00000520978.5; ENST00000523629.5; ENST00000518361.1; ENST00000265814.4; ENST00000422361.6; ENST00000617740.4; ENST00000613302.4; ENST00000436581.6; ENST00000615601.4; ENST00000521751.5; ENST00000360348.6 | ||
| External Link | RMBase: m6A_site_802996 | ||
| mod ID: M6ASITE085849 | Click to Show/Hide the Full List | ||
| mod site | chr8:91991655-91991656:- | ||
| Sequence | CAGCCACAGGGACCTCAGGGACAGAAACAGACCTATGGGTA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000518844.5; ENST00000617740.4; ENST00000615601.4; ENST00000613886.4; ENST00000521751.5; ENST00000518361.1; ENST00000436581.6; ENST00000613302.4; ENST00000523629.5; ENST00000520978.5; ENST00000614812.4; ENST00000396218.5; ENST00000520724.5; ENST00000360348.6; ENST00000422361.6; ENST00000265814.4 | ||
| External Link | RMBase: m6A_site_802997 | ||
| mod ID: M6ASITE085850 | Click to Show/Hide the Full List | ||
| mod site | chr8:91991664-91991665:- | ||
| Sequence | TCGACACCCCAGCCACAGGGACCTCAGGGACAGAAACAGAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000520978.5; ENST00000520724.5; ENST00000422361.6; ENST00000613302.4; ENST00000396218.5; ENST00000360348.6; ENST00000615601.4; ENST00000617740.4; ENST00000518844.5; ENST00000614812.4; ENST00000518361.1; ENST00000436581.6; ENST00000265814.4; ENST00000523629.5; ENST00000613886.4; ENST00000521751.5 | ||
| External Link | RMBase: m6A_site_802998 | ||
| mod ID: M6ASITE085851 | Click to Show/Hide the Full List | ||
| mod site | chr8:91991691-91991692:- | ||
| Sequence | CATTGCCCACCACTACAGGGACTCCTATCGACACCCCAGCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000436581.6; ENST00000360348.6; ENST00000617740.4; ENST00000422361.6; ENST00000615601.4; ENST00000613886.4; ENST00000520978.5; ENST00000613302.4; ENST00000518361.1; ENST00000523629.5; ENST00000396218.5; ENST00000521751.5; ENST00000520724.5; ENST00000518844.5; ENST00000614812.4; ENST00000265814.4; ENST00000520047.1 | ||
| External Link | RMBase: m6A_site_802999 | ||
| mod ID: M6ASITE085852 | Click to Show/Hide the Full List | ||
| mod site | chr8:91991846-91991847:- | [5] | |
| Sequence | AGAGAGCCTTTGCACTCAGAACATCCAAGCAAGCGACCATG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000613302.4; ENST00000617740.4; ENST00000614812.4; ENST00000436581.6; ENST00000422361.6; ENST00000613886.4; ENST00000360348.6; ENST00000518844.5; ENST00000523629.5; ENST00000265814.4; ENST00000520978.5; ENST00000520724.5; ENST00000615601.4; ENST00000396218.5; ENST00000520047.1; ENST00000518361.1 | ||
| External Link | RMBase: m6A_site_803000 | ||
| mod ID: M6ASITE085853 | Click to Show/Hide the Full List | ||
| mod site | chr8:91994550-91994551:- | [5] | |
| Sequence | CTAGTCATGGAAGAGCCAGGACTAGATCTCAGGTCTCTTGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000614812.4; ENST00000520047.1; ENST00000613302.4; ENST00000396218.5; ENST00000523629.5; ENST00000520724.5; ENST00000265814.4; ENST00000436581.6; ENST00000615601.4; ENST00000617740.4; ENST00000613886.4; ENST00000518361.1; ENST00000520978.5; ENST00000518844.5; ENST00000422361.6; ENST00000360348.6 | ||
| External Link | RMBase: m6A_site_803001 | ||
References