General Information of the m6A Target Gene (ID: M6ATAR00328)
Target Name Mitogen-activated protein kinase 3 (ERK1/MAPK3)
Synonyms
MAP kinase 3; MAPK 3; ERT2; Extracellular signal-regulated kinase 1; ERK-1; Insulin-stimulated MAP2 kinase; MAP kinase isoform p44; p44-MAPK; Microtubule-associated protein 2 kinase; p44-ERK1; ERK1; PRKM3
    Click to Show/Hide
Gene Name MAPK3
Chromosomal Location 16p11.2
Family protein kinase superfamily; CMGC Ser/Thr protein kinase family; MAP kinase subfamily
Function
Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK1/ERK2 and MAPK3/ERK1 are the 2 MAPKs which play an important role in the MAPK/ERK cascade. They participate also in a signaling cascade initiated by activated KIT and KITLG/SCF. Depending on the cellular context, the MAPK/ERK cascade mediates diverse biological functions such as cell growth, adhesion, survival and differentiation through the regulation of transcription, translation, cytoskeletal rearrangements. The MAPK/ERK cascade plays also a role in initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors. About 160 substrates have already been discovered for ERKs. Many of these substrates are localized in the nucleus, and seem to participate in the regulation of transcription upon stimulation. However, other substrates are found in the cytosol as well as in other cellular organelles, and those are responsible for processes such as translation, mitosis and apoptosis. Moreover, the MAPK/ERK cascade is also involved in the regulation of the endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC); as well as in the fragmentation of the Golgi apparatus during mitosis. The substrates include transcription factors (such as ATF2, BCL6, ELK1, ERF, FOS, HSF4 or SPZ1), cytoskeletal elements (such as CANX, CTTN, GJA1, MAP2, MAPT, PXN, SORBS3 or STMN1), regulators of apoptosis (such as BAD, BTG2, CASP9, DAPK1, IER3, MCL1 or PPARG), regulators of translation (such as EIF4EBP1) and a variety of other signaling-related molecules (like ARHGEF2, FRS2 or GRB10). Protein kinases (such as RAF1, RPS6KA1/RSK1, RPS6KA3/RSK2, RPS6KA2/RSK3, RPS6KA6/RSK4, SYK, MKNK1/MNK1, MKNK2/MNK2, RPS6KA5/MSK1, RPS6KA4/MSK2, MAPKAPK3 or MAPKAPK5) and phosphatases (such as DUSP1, DUSP4, DUSP6 or DUSP16) are other substrates which enable the propagation the MAPK/ERK signal to additional cytosolic and nuclear targets, thereby extending the specificity of the cascade.
    Click to Show/Hide
Gene ID 5595
Uniprot ID
MK03_HUMAN
HGNC ID
HGNC:6877
KEGG ID
hsa:5595
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MAPK3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, Mitogen-activated protein kinase 3 (ERK1/MAPK3), AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion.
Target Regulation Up regulation
Responsed Disease Gangrene or necrosis of lung ICD-11: CA43
Pathway Response MAPK signaling pathway hsa04010
PI3K-Akt signaling pathway hsa04151
Apoptosis hsa04210
Cell Process Biological regulation
Cell apoptosis
In-vitro Model BEAS-2B Normal Homo sapiens CVCL_0168
In-vivo Model After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.
Gangrene or necrosis of lung [ICD-11: CA43]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, Mitogen-activated protein kinase 3 (ERK1/MAPK3), AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited p-p65, IL-1-beta and TNF-alpha secretion.
Responsed Disease Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) READER
Target Regulation Up regulation
Pathway Response MAPK signaling pathway hsa04010
PI3K-Akt signaling pathway hsa04151
Apoptosis hsa04210
Cell Process Biological regulation
Cell apoptosis
In-vitro Model BEAS-2B Normal Homo sapiens CVCL_0168
In-vivo Model After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00328)
Mitogen-activated protein kinase 3 (ERK1/MAPK3)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007286 Click to Show/Hide the Full List
mod site chr16:30118978-30118979:- [3]
Sequence CAGTTAATTTTGCTATTTTTAGTAGAGACAGGGTTTTGCCA
Transcript ID List ENST00000395199.7; ENST00000484663.5; ENST00000478356.5; ENST00000395200.5; ENST00000483869.1; ENST00000466521.5; ENST00000395202.5; ENST00000263025.9; ENST00000322266.9; ENST00000481230.1; ENST00000490298.5
External Link RMBase: RNA-editing_site_50621
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000647 Click to Show/Hide the Full List
mod site chr16:30117205-30117206:- [4]
Sequence AACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTG
Cell/Tissue List frontalcortex; HEK293T; lung; HeLa; T24
Seq Type List Bisulfite-seq; m5C-RIP-seq
Transcript ID List ENST00000466521.5; ENST00000322266.9; ENST00000461737.5; ENST00000490298.5; ENST00000395200.5; ENST00000484663.5; ENST00000263025.9; ENST00000395202.5; ENST00000478356.5; ENST00000395199.7
External Link RMBase: m5C_site_15827
N6-methyladenosine (m6A)
In total 43 m6A sequence/site(s) in this target gene
mod ID: M6ASITE026582 Click to Show/Hide the Full List
mod site chr16:30114306-30114307:- [5]
Sequence ACCCTAGTTTCCCTGAAGGAACATTCCTTAGTCTCAAGGGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; MT4; Huh7
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000484663.5; ENST00000490298.5; ENST00000263025.9; ENST00000485579.1; ENST00000322266.9; ENST00000466521.5
External Link RMBase: m6A_site_316282
mod ID: M6ASITE026583 Click to Show/Hide the Full List
mod site chr16:30114331-30114332:- [5]
Sequence GCCCCCCTCATCTCATTCAAACCCCACCCTAGTTTCCCTGA
Motif Score 2.185083333
Cell/Tissue List HeLa; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000466521.5; ENST00000484663.5; ENST00000485579.1; ENST00000263025.9; ENST00000490298.5; ENST00000322266.9
External Link RMBase: m6A_site_316283
mod ID: M6ASITE026584 Click to Show/Hide the Full List
mod site chr16:30114367-30114368:- [5]
Sequence GTGGGGGGCGCTGAGTAGGGACTCAGGGCCATGCCTGCCCC
Motif Score 4.065041667
Cell/Tissue List HeLa; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000466521.5; ENST00000485579.1; ENST00000484663.5; ENST00000490298.5; ENST00000263025.9; ENST00000322266.9
External Link RMBase: m6A_site_316284
mod ID: M6ASITE026585 Click to Show/Hide the Full List
mod site chr16:30114519-30114520:- [5]
Sequence CCTCCCCACGGGGCCTCGGGACCTCAGGTGGCCCCAGTTCA
Motif Score 3.622404762
Cell/Tissue List HeLa; MM6; HEK293T; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000322266.9; ENST00000485579.1; ENST00000263025.9; ENST00000466521.5; ENST00000484663.5; ENST00000490298.5
External Link RMBase: m6A_site_316285
mod ID: M6ASITE026586 Click to Show/Hide the Full List
mod site chr16:30114642-30114643:- [5]
Sequence GGACACTGTGCCCAGCCCGGACCTTGGCAGCCCAGGCCGGG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; H1A; hESCs; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000466521.5; ENST00000494643.1; ENST00000484663.5; ENST00000490298.5; ENST00000263025.9; ENST00000322266.9; ENST00000485579.1; ENST00000461737.5
External Link RMBase: m6A_site_316286
mod ID: M6ASITE026587 Click to Show/Hide the Full List
mod site chr16:30114660-30114661:- [5]
Sequence GCCAGACTGTTAGAAAATGGACACTGTGCCCAGCCCGGACC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; H1A; hESCs; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000263025.9; ENST00000461737.5; ENST00000485579.1; ENST00000494643.1; ENST00000484663.5; ENST00000466521.5; ENST00000490298.5; ENST00000322266.9
External Link RMBase: m6A_site_316287
mod ID: M6ASITE026588 Click to Show/Hide the Full List
mod site chr16:30114675-30114676:- [5]
Sequence GCCTGCCCCTCTCCCGCCAGACTGTTAGAAAATGGACACTG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; H1A; hESCs; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000322266.9; ENST00000466521.5; ENST00000485579.1; ENST00000494643.1; ENST00000263025.9; ENST00000490298.5; ENST00000461737.5; ENST00000484663.5
External Link RMBase: m6A_site_316288
mod ID: M6ASITE026589 Click to Show/Hide the Full List
mod site chr16:30115637-30115638:- [5]
Sequence AATCTCCTTCTAGGAACAGAACTGGCAAAGAGGCAAGAGGT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000490298.5; ENST00000263025.9; ENST00000466521.5; ENST00000322266.9; ENST00000485579.1; ENST00000484663.5; ENST00000461737.5; ENST00000494643.1
External Link RMBase: m6A_site_316289
mod ID: M6ASITE026590 Click to Show/Hide the Full List
mod site chr16:30115642-30115643:- [5]
Sequence ATTCTAATCTCCTTCTAGGAACAGAACTGGCAAAGAGGCAA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000466521.5; ENST00000484663.5; ENST00000322266.9; ENST00000461737.5; ENST00000494643.1; ENST00000485579.1; ENST00000263025.9; ENST00000490298.5
External Link RMBase: m6A_site_316290
mod ID: M6ASITE026591 Click to Show/Hide the Full List
mod site chr16:30115738-30115739:- [5]
Sequence AAATGCCCAAGGCTGCCCAGACTGGTGGCCCACCGAGTCCT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000494643.1; ENST00000263025.9; ENST00000490298.5; ENST00000461737.5; ENST00000484663.5; ENST00000485579.1; ENST00000466521.5; ENST00000322266.9
External Link RMBase: m6A_site_316291
mod ID: M6ASITE026592 Click to Show/Hide the Full List
mod site chr16:30115782-30115783:- [5]
Sequence AGCCTGGACTACAGAGCAAGACTCCATCTCAAAAAAAAAAA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000466521.5; ENST00000494643.1; ENST00000484663.5; ENST00000490298.5; rmsk_4510886; ENST00000322266.9; ENST00000461737.5; ENST00000485579.1; ENST00000263025.9
External Link RMBase: m6A_site_316292
mod ID: M6ASITE026593 Click to Show/Hide the Full List
mod site chr16:30115951-30115952:- [6]
Sequence AGCCTGGCCAACATGGTGAAACCCGGTCTCTACTGTAAAGA
Motif Score 2.185083333
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000466521.5; ENST00000490298.5; ENST00000485579.1; ENST00000263025.9; ENST00000322266.9; ENST00000494643.1; ENST00000484663.5; ENST00000461737.5; rmsk_4510886
External Link RMBase: m6A_site_316293
mod ID: M6ASITE026594 Click to Show/Hide the Full List
mod site chr16:30115974-30115975:- [6]
Sequence TCACAAGGTCAAGAGTTGAGACCAGCCTGGCCAACATGGTG
Motif Score 2.876744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000466521.5; rmsk_4510886; ENST00000263025.9; ENST00000484663.5; ENST00000494643.1; ENST00000461737.5; ENST00000490298.5; ENST00000485579.1; ENST00000322266.9
External Link RMBase: m6A_site_316294
mod ID: M6ASITE026595 Click to Show/Hide the Full List
mod site chr16:30116657-30116658:- [7]
Sequence AGGCCCCCTAGCCCAGACAGACATCTCTGCACCCTGGGGCC
Motif Score 2.897386905
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000263025.9; ENST00000473431.1; ENST00000490298.5; ENST00000484663.5; ENST00000461737.5; ENST00000395200.5; ENST00000466521.5; ENST00000322266.9; ENST00000485579.1
External Link RMBase: m6A_site_316295
mod ID: M6ASITE026596 Click to Show/Hide the Full List
mod site chr16:30116661-30116662:- [5]
Sequence CTGGAGGCCCCCTAGCCCAGACAGACATCTCTGCACCCTGG
Motif Score 2.897386905
Cell/Tissue List HeLa; MM6; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000485579.1; ENST00000484663.5; ENST00000263025.9; ENST00000322266.9; ENST00000461737.5; ENST00000466521.5; ENST00000490298.5; ENST00000473431.1; ENST00000395200.5
External Link RMBase: m6A_site_316296
mod ID: M6ASITE026597 Click to Show/Hide the Full List
mod site chr16:30116705-30116706:- [7]
Sequence AGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGA
Motif Score 2.897386905
Cell/Tissue List HEK293T; Huh7; endometrial
Seq Type List DART-seq; MeRIP-seq; m6A-seq
Transcript ID List ENST00000490298.5; ENST00000395200.5; ENST00000466521.5; ENST00000461737.5; ENST00000484663.5; ENST00000473431.1; ENST00000263025.9; ENST00000485579.1; ENST00000478356.5; ENST00000395202.5; ENST00000322266.9
External Link RMBase: m6A_site_316297
mod ID: M6ASITE026598 Click to Show/Hide the Full List
mod site chr16:30116987-30116988:- [8]
Sequence CATAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACC
Motif Score 3.622404762
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000395202.5; ENST00000478356.5; ENST00000484663.5; ENST00000395200.5; ENST00000490298.5; ENST00000473431.1; ENST00000263025.9; ENST00000395199.7; ENST00000466521.5; ENST00000322266.9; ENST00000461737.5
External Link RMBase: m6A_site_316298
mod ID: M6ASITE026599 Click to Show/Hide the Full List
mod site chr16:30117072-30117073:- [8]
Sequence CCCAGCAGCCGCTGGAGGAGACAGGCAAAGCAATGCTTCTC
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000478356.5; ENST00000395200.5; ENST00000263025.9; ENST00000395199.7; ENST00000461737.5; ENST00000473431.1; ENST00000484663.5; ENST00000466521.5; ENST00000490298.5; ENST00000395202.5; ENST00000322266.9
External Link RMBase: m6A_site_316299
mod ID: M6ASITE026600 Click to Show/Hide the Full List
mod site chr16:30117217-30117218:- [9]
Sequence ATGAAGGCCCGAAACTACCTACAGTCTCTGCCCTCCAAGAC
Motif Score 2.078666667
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000322266.9; ENST00000395200.5; ENST00000490298.5; ENST00000484663.5; ENST00000395199.7; ENST00000263025.9; ENST00000395202.5; ENST00000478356.5; ENST00000461737.5; ENST00000466521.5
External Link RMBase: m6A_site_316300
mod ID: M6ASITE026601 Click to Show/Hide the Full List
mod site chr16:30117239-30117240:- [10]
Sequence GGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTACC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395202.5; ENST00000461737.5; ENST00000263025.9; ENST00000484663.5; ENST00000466521.5; ENST00000478356.5; ENST00000322266.9; ENST00000490298.5; ENST00000395199.7; ENST00000395200.5
External Link RMBase: m6A_site_316301
mod ID: M6ASITE026602 Click to Show/Hide the Full List
mod site chr16:30117257-30117258:- [8]
Sequence GGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACA
Motif Score 3.622404762
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000461737.5; ENST00000395200.5; ENST00000322266.9; ENST00000395199.7; ENST00000466521.5; ENST00000263025.9; ENST00000395202.5; ENST00000478356.5; ENST00000490298.5; ENST00000484663.5
External Link RMBase: m6A_site_316302
mod ID: M6ASITE026603 Click to Show/Hide the Full List
mod site chr16:30117677-30117678:- [10]
Sequence CTACCTGGATCAGCTCAACCACATTCTGGGTGAGGGAGGCC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395199.7; ENST00000478356.5; ENST00000490298.5; ENST00000322266.9; ENST00000395200.5; ENST00000263025.9; ENST00000395202.5; ENST00000484663.5; ENST00000466521.5
External Link RMBase: m6A_site_316303
mod ID: M6ASITE026604 Click to Show/Hide the Full List
mod site chr16:30117764-30117765:- [10]
Sequence GGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCA
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000466521.5; ENST00000484663.5; ENST00000395202.5; ENST00000395199.7; ENST00000478356.5; ENST00000395200.5; ENST00000263025.9; ENST00000322266.9; ENST00000490298.5
External Link RMBase: m6A_site_316304
mod ID: M6ASITE026605 Click to Show/Hide the Full List
mod site chr16:30117973-30117974:- [11]
Sequence TGGAGCTACCTCTGAGCCAGACACTGACCCCCATGACACAG
Motif Score 2.897386905
Cell/Tissue List HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000263025.9; ENST00000395199.7; ENST00000484663.5; ENST00000478356.5; ENST00000395200.5; ENST00000490298.5; ENST00000466521.5; ENST00000395202.5; ENST00000483869.1; ENST00000322266.9
External Link RMBase: m6A_site_316305
mod ID: M6ASITE026606 Click to Show/Hide the Full List
mod site chr16:30118012-30118013:- [11]
Sequence CCCACTCCTGAAAGGAACGGACCAGTTCCCAGGAAGCCCTG
Motif Score 3.622404762
Cell/Tissue List HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000484663.5; ENST00000478356.5; ENST00000483869.1; ENST00000490298.5; ENST00000395200.5; ENST00000322266.9; ENST00000466521.5; ENST00000395202.5; ENST00000263025.9; ENST00000395199.7
External Link RMBase: m6A_site_316306
mod ID: M6ASITE026607 Click to Show/Hide the Full List
mod site chr16:30118053-30118054:- [11]
Sequence GGCCCCAGAGATCATGCTGAACTCCAAGGTAGGAGGGGCTG
Motif Score 3.373380952
Cell/Tissue List HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000478356.5; ENST00000263025.9; ENST00000395202.5; ENST00000322266.9; ENST00000395200.5; ENST00000484663.5; ENST00000395199.7; ENST00000466521.5; ENST00000483869.1; ENST00000490298.5
External Link RMBase: m6A_site_316307
mod ID: M6ASITE026608 Click to Show/Hide the Full List
mod site chr16:30118116-30118117:- [10]
Sequence TGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000490298.5; ENST00000483869.1; ENST00000395202.5; ENST00000484663.5; ENST00000322266.9; ENST00000466521.5; ENST00000478356.5; ENST00000481230.1; ENST00000395199.7; ENST00000395200.5; ENST00000263025.9
External Link RMBase: m6A_site_316308
mod ID: M6ASITE026609 Click to Show/Hide the Full List
mod site chr16:30118367-30118368:- [10]
Sequence GCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000483869.1; ENST00000481230.1; ENST00000484663.5; ENST00000490298.5; ENST00000263025.9; ENST00000395202.5; ENST00000478356.5; ENST00000395200.5; ENST00000395199.7; ENST00000466521.5; ENST00000322266.9
External Link RMBase: m6A_site_316309
mod ID: M6ASITE026610 Click to Show/Hide the Full List
mod site chr16:30118424-30118425:- [10]
Sequence GATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGC
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000466521.5; ENST00000322266.9; ENST00000478356.5; ENST00000483869.1; ENST00000490298.5; ENST00000395199.7; ENST00000263025.9; ENST00000395202.5; ENST00000481230.1; ENST00000395200.5; ENST00000484663.5
External Link RMBase: m6A_site_316310
mod ID: M6ASITE026611 Click to Show/Hide the Full List
mod site chr16:30118502-30118503:- [10]
Sequence CCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGC
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395202.5; ENST00000466521.5; ENST00000395199.7; ENST00000484663.5; ENST00000322266.9; ENST00000490298.5; ENST00000395200.5; ENST00000263025.9; ENST00000478356.5; ENST00000481230.1; ENST00000483869.1
External Link RMBase: m6A_site_316311
mod ID: M6ASITE026612 Click to Show/Hide the Full List
mod site chr16:30118512-30118513:- [5]
Sequence TTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; MT4; Huh7; CD4T; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000483869.1; ENST00000395202.5; ENST00000395200.5; ENST00000395199.7; ENST00000322266.9; ENST00000466521.5; ENST00000481230.1; ENST00000478356.5; ENST00000490298.5; ENST00000263025.9; ENST00000484663.5
External Link RMBase: m6A_site_316312
mod ID: M6ASITE026613 Click to Show/Hide the Full List
mod site chr16:30118523-30118524:- [5]
Sequence CCTCAGCTACATTGTGCAGGACCTGATGGAGACTGACCTGT
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000466521.5; ENST00000395199.7; ENST00000483869.1; ENST00000263025.9; ENST00000484663.5; ENST00000481230.1; ENST00000322266.9; ENST00000478356.5; ENST00000395200.5; ENST00000490298.5; ENST00000395202.5
External Link RMBase: m6A_site_316313
mod ID: M6ASITE026614 Click to Show/Hide the Full List
mod site chr16:30118535-30118536:- [10]
Sequence CTGCGGAACCATCCTCAGCTACATTGTGCAGGACCTGATGG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000483869.1; ENST00000478356.5; ENST00000484663.5; ENST00000263025.9; ENST00000395199.7; ENST00000395202.5; ENST00000322266.9; ENST00000395200.5; ENST00000490298.5; ENST00000466521.5; ENST00000481230.1
External Link RMBase: m6A_site_316314
mod ID: M6ASITE026615 Click to Show/Hide the Full List
mod site chr16:30121862-30121863:- [5]
Sequence GAATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4; MM6
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000395200.5; ENST00000478356.5; ENST00000481230.1; ENST00000490298.5; ENST00000466521.5; ENST00000322266.9; ENST00000483869.1; ENST00000395199.7; ENST00000395202.5; ENST00000484663.5; ENST00000263025.9
External Link RMBase: m6A_site_316315
mod ID: M6ASITE026616 Click to Show/Hide the Full List
mod site chr16:30121938-30121939:- [5]
Sequence TCAGCCCCTTCGAACATCAGACCTACTGCCAGCGCACGCTC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000466521.5; ENST00000483869.1; ENST00000263025.9; ENST00000484663.5; ENST00000490298.5; ENST00000481230.1; ENST00000478356.5; ENST00000395200.5; ENST00000322266.9; ENST00000395199.7; ENST00000395202.5
External Link RMBase: m6A_site_316316
mod ID: M6ASITE026617 Click to Show/Hide the Full List
mod site chr16:30121945-30121946:- [5]
Sequence AAGAAGATCAGCCCCTTCGAACATCAGACCTACTGCCAGCG
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; hESC-HEK293T; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000395202.5; ENST00000466521.5; ENST00000490298.5; ENST00000481230.1; ENST00000263025.9; ENST00000395199.7; ENST00000484663.5; ENST00000322266.9; ENST00000395200.5; ENST00000478356.5; ENST00000483869.1
External Link RMBase: m6A_site_316317
mod ID: M6ASITE026618 Click to Show/Hide the Full List
mod site chr16:30121980-30121981:- [5]
Sequence CCTATGACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000490298.5; ENST00000484663.5; ENST00000395202.5; ENST00000322266.9; ENST00000395199.7; ENST00000481230.1; ENST00000466521.5; ENST00000395200.5; ENST00000263025.9; ENST00000478356.5; ENST00000483869.1
External Link RMBase: m6A_site_316318
mod ID: M6ASITE026619 Click to Show/Hide the Full List
mod site chr16:30122054-30122055:- [5]
Sequence GGTGGGGCCACCAGGCCCGGACTCCCCCTTTGTAAGGCCAC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; Jurkat; CD4T; GSC-11; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000322266.9; ENST00000466521.5; ENST00000484663.5; ENST00000481230.1; ENST00000263025.9; ENST00000395202.5; ENST00000395200.5; ENST00000490298.5; ENST00000395199.7; ENST00000478356.5; ENST00000483869.1
External Link RMBase: m6A_site_316319
mod ID: M6ASITE026620 Click to Show/Hide the Full List
mod site chr16:30122138-30122139:- [5]
Sequence GGCCTCCACAGCAGGAAGGAACCAGCATTGTTTATGATTTG
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000395202.5; ENST00000395199.7; ENST00000263025.9; ENST00000483869.1; ENST00000478356.5; ENST00000490298.5; ENST00000481230.1; ENST00000395200.5; ENST00000322266.9; ENST00000466521.5; ENST00000484663.5
External Link RMBase: m6A_site_316320
mod ID: M6ASITE026621 Click to Show/Hide the Full List
mod site chr16:30122918-30122919:- [5]
Sequence GCGTCCCGAGGAGGCAGGAGACTCGGGATGATCGGGAGCGT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000395202.5; ENST00000466521.5; ENST00000490298.5; ENST00000484663.5; ENST00000483869.1; ENST00000263025.9; ENST00000478356.5; ENST00000322266.9; ENST00000481230.1; ENST00000395199.7; ENST00000395200.5
External Link RMBase: m6A_site_316321
mod ID: M6ASITE026622 Click to Show/Hide the Full List
mod site chr16:30123069-30123070:- [10]
Sequence GCGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000481230.1; ENST00000466521.5; ENST00000395199.7; ENST00000322266.9; ENST00000490298.5; ENST00000263025.9; ENST00000395200.5; ENST00000395202.5; ENST00000483869.1
External Link RMBase: m6A_site_316322
mod ID: M6ASITE026623 Click to Show/Hide the Full List
mod site chr16:30123084-30123085:- [10]
Sequence GTTCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000263025.9; ENST00000322266.9; ENST00000466521.5; ENST00000395199.7; ENST00000395200.5; ENST00000490298.5; ENST00000395202.5; ENST00000483869.1; ENST00000481230.1
External Link RMBase: m6A_site_316323
mod ID: M6ASITE026624 Click to Show/Hide the Full List
mod site chr16:30123160-30123161:- [5]
Sequence GGGGCGGGGAGCCCCGTAGAACCGAGGGGGTCGGCCCGGGG
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; H1B; H1A; A549; H1299; Jurkat; GSC-11; HEK293A-TOA; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000490298.5; ENST00000466521.5; ENST00000322266.9; ENST00000263025.9; ENST00000395202.5; ENST00000481230.1; ENST00000395199.7
External Link RMBase: m6A_site_316324