m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00316)
Target Name Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4)
Gene Name LILRB4
Chromosomal Location 19q13.42
Function
Inhibitory receptor involved in the down-regulation of the immune response and the development of immune tolerance. Receptor for FN1. Receptor for apolipoprotein APOE. Receptor for ALCAM/CD166. Inhibits receptor-mediated phosphorylation of cellular proteins and mobilization of intracellular calcium ions. Inhibits FCGR1A/CD64-mediated monocyte activation by inducing phosphatase-mediated down-regulation of the phosphorylation of multiple proteins including LCK, SYK, LAT and ERK, leading to a reduction in TNF production. This inhibition of monocyte activation occurs at least in part via binding to FN1. Inhibits T cell proliferation, inducing anergy, suppressing the differentiation of IFNG-producing CD8+ cytoxic T cells and enhancing the generation of CD8+ T suppressor cells. Induces up-regulation of CD86 on dendritic cells. Interferes with TNFRSF5-signaling and NF-kappa-B up-regulation.
    Click to Show/Hide
Gene ID 11006
Uniprot ID
LIRB4_HUMAN
HGNC ID
HGNC:6608
KEGG ID
hsa:11006
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LILRB4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line Mouse liver Mus musculus
Treatment: FTO knockout mouse liver tissue
Control: Wild type mouse liver tissue
 GSE125785
Regulation
logFC: 1.12E+00
p-value: 2.09E-02
More Results Click to View More RNA-seq Results
In total 7 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Responsed Drug Meclofenamic acid Approved
 Drug Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Responsed Drug R-2HG Investigative
 Drug Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 5 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 6 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 7 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Acute myeloid leukaemia [ICD-11: 2A60]
 Disease Info 
In total 7 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Meclofenamic acid Approved
 Drug Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug R-2HG Investigative
 Drug Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 3 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 4 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 5 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 6 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Experiment 7 Reporting the m6A-centered Disease Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
Meclofenamic acid [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
R-2HG [Investigative]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary Genetic depletion and pharmacological inhibition of FTO dramatically attenuate leukemia stem/initiating cell self-renewal and reprogram immune response by suppressing expression of immune checkpoint genes, especially Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4). FTO inhibitors, such as rhein, meclofenamic acid (MA), MO-I-500, fluorescein, and R-2HG, can inhibit acute myeloid leukemia cell viability. CS1 and CS2 displayed a much higher efficacy in inhibiting AML cell viability.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Pathway Response B cell receptor signaling pathway hsa04662
Cell Process Immune Evasion
In-vitro Model MV4-11 Childhood acute monocytic leukemia Homo sapiens CVCL_0064
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
U-937 Adult acute monocytic leukemia Homo sapiens CVCL_0007
In-vivo Model For each experiment, 6- to 8-week-old mice were used and randomly allocated to each group. For xenograft mouse, 0.1 × 106 MA9.3ITD cells were transplanted into NRGS recipient mice intravenously. Drug treatment was started from 10 days after transplantation. CS2 was administered through intraperitoneal (i.p.) injection at 5mg/kg/day, every other day. CS1 dissolved in saturated Beta-cyclodextrin (C0926, Sigma-Aldrich) solution was delivered by intravenous injection (i.v.). Successful engraftment was observed following 4 weeks post inoculation displaying a level of about 5% human CD33+ cells in peripheral. To generate PDX mouse models, 1 × 106 AML patient derived BMMNCs were transplanted into NRGS recipient mice intravenously, and drug treatment was started from 7 days later. CS2, FB23-2, and free CS1 were administered through i.p. injection at 5 mg/kg/day, while Micelle (900661, Sigma-Aldrich) packaged CS1 was delivered by i.v. injection at 5mg/kg/day. Both CS1 and CS2 were injected every other day for a total of ten times.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00316)
Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009297 Click to Show/Hide the Full List
mod site chr19:54656710-54656711:+ [2]
Sequence TGGCTTATTTCACTGACCATAATGACCTCCAGTTCCAACTA
Transcript ID List ENST00000270452.6
External Link RMBase: RNA-editing_site_72926
mod ID: A2ISITE009298 Click to Show/Hide the Full List
mod site chr19:54656730-54656731:+ [2]
Sequence AATGACCTCCAGTTCCAACTATGTTGCTGTAAATGTCAGGA
Transcript ID List ENST00000270452.6
External Link RMBase: RNA-editing_site_72927