m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00310)

Target Name	Krueppel-like factor 4 (KLF4)
Synonyms	Epithelial zinc finger protein EZF; Gut-enriched krueppel-like factor; EZF; GKLF Click to Show/Hide
Gene Name	KLF4
Chromosomal Location	9q31.2
Family	krueppel C2H2-type zinc-finger protein family
Function	Transcription factor; can act both as activator and as repressor. Binds the 5'-CACCC-3' core sequence. Binds to the promoter region of its own gene and can activate its own transcription. Regulates the expression of key transcription factors during embryonic development. Plays an important role in maintaining embryonic stem cells, and in preventing their differentiation. Required for establishing the barrier function of the skin and for postnatal maturation and maintenance of the ocular surface. Involved in the differentiation of epithelial cells and may also function in skeletal and kidney development. Contributes to the down-regulation of p53/TP53 transcription. Click to Show/Hide
Gene ID	9314
Uniprot ID	KLF4_HUMAN
HGNC ID	HGNC:6348
KEGG ID	hsa:9314

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

KLF4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	GSC11 cell line	Homo sapiens
Treatment: siYTHDF2 GSC11 cells Control: siControl GSC11 cells		GSE142825
Regulation		logFC: 6.24E-01 p-value: 8.92E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between KLF4 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.55E+00	GSE49339

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	MiR-1915-3p expression was regulated by METTL3/YTHDF2 m6A axis through transcription factor Krueppel-like factor 4 (KLF4). miR-1915-3p function as a tumor suppressor by targeting SET and has an anti-metastatic therapeutic potential for lung cancer treatment.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	TNF signaling pathway			hsa04668
Cell Process	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3/YTHDF2/SETD7/Krueppel-like factor 4 (KLF4) m6 A axis provide the insight into the underlying mechanism of carcinogenesis and highlight potential therapeutic targets for bladder cancer.
Target Regulation	Down regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Cell Process	Cancer proliferation
	Cancer metastasis
In-vitro Model	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, UM-UC-3 cells (2 × 10⁶ cells per mouse) stably METTL3 knocked down (shMETTL3-1, shMETTL3-2) were injected into the flanks of mice.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells Control: MDA-MB-231 cells		GSE81164
Regulation		logFC: -8.55E-01 p-value: 7.89E-09
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	The expression of METTL14 was downregulated in CRC cells and METTL14 could inhibit the metastasis of CRC cells. MeCP2 could bind to METTL14 to coregulate tumor suppressor Krueppel-like factor 4 (KLF4) expression through changing m6 A methylation modification.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
In-vivo Model	In vivo, the group of HCT116 cells labeled with luciferase were surgically injected into the spleen of nude mice. After 2 months, the nude mice were subjected to D-luciferin injection and the luciferase signals were monitored and quantified.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HUVEC cell line	Homo sapiens
Treatment: shMETTL3 HUVEC cells Control: shScramble HUVEC cells		GSE157544
Regulation		logFC: -8.63E-01 p-value: 1.22E-04
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	MiR-1915-3p expression was regulated by METTL3/YTHDF2 m6A axis through transcription factor Krueppel-like factor 4 (KLF4). miR-1915-3p function as a tumor suppressor by targeting SET and has an anti-metastatic therapeutic potential for lung cancer treatment.
Target Regulation	Down regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	TNF signaling pathway			hsa04668
Cell Process	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3/YTHDF2/SETD7/Krueppel-like factor 4 (KLF4) m6 A axis provide the insight into the underlying mechanism of carcinogenesis and highlight potential therapeutic targets for bladder cancer.
Target Regulation	Down regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Cell Process	Cancer proliferation
	Cancer metastasis
In-vitro Model	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, UM-UC-3 cells (2 × 10⁶ cells per mouse) stably METTL3 knocked down (shMETTL3-1, shMETTL3-2) were injected into the flanks of mice.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	In the in vivo atherosclerosis model,partial ligation of the carotid artery led to plaque formation and up-regulation of METTL3 and NLRP1, with down-regulation of KLF4; knockdown of METTL3 via repetitive shRNA administration prevented the atherogenic process, NLRP1 up-regulation, and Krueppel-like factor 4 (KLF4) down-regulation. Collectively, it has demonstrated that METTL3 serves a central role in the atherogenesis induced by oscillatory stress and disturbed blood flow.
Target Regulation	Down regulation
Responsed Disease	Atherosclerosis		ICD-11: BD40.Z	Disease Info
In-vitro Model	MAEC	Normal	Mus musculus	CVCL_U411
	HUVEC-C	Normal	Homo sapiens	CVCL_2959

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	The expression of METTL14 was downregulated in CRC cells and METTL14 could inhibit the metastasis of CRC cells. MeCP2 could bind to METTL14 to coregulate tumor suppressor Krueppel-like factor 4 (KLF4) expression through changing m6 A methylation modification.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
In-vivo Model	In vivo, the group of HCT116 cells labeled with luciferase were surgically injected into the spleen of nude mice. After 2 months, the nude mice were subjected to D-luciferin injection and the luciferase signals were monitored and quantified.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	MiR-1915-3p expression was regulated by METTL3/YTHDF2 m6A axis through transcription factor Krueppel-like factor 4 (KLF4). miR-1915-3p function as a tumor suppressor by targeting SET and has an anti-metastatic therapeutic potential for lung cancer treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	TNF signaling pathway			hsa04668
Cell Process	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	MiR-1915-3p expression was regulated by METTL3/YTHDF2 m6A axis through transcription factor Krueppel-like factor 4 (KLF4). miR-1915-3p function as a tumor suppressor by targeting SET and has an anti-metastatic therapeutic potential for lung cancer treatment.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	TNF signaling pathway			hsa04668
Cell Process	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition
In-vitro Model	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3/YTHDF2/SETD7/Krueppel-like factor 4 (KLF4) m6 A axis provide the insight into the underlying mechanism of carcinogenesis and highlight potential therapeutic targets for bladder cancer.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cancer proliferation
	Cancer metastasis
In-vitro Model	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, UM-UC-3 cells (2 × 10⁶ cells per mouse) stably METTL3 knocked down (shMETTL3-1, shMETTL3-2) were injected into the flanks of mice.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3/YTHDF2/SETD7/Krueppel-like factor 4 (KLF4) m6 A axis provide the insight into the underlying mechanism of carcinogenesis and highlight potential therapeutic targets for bladder cancer.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cancer proliferation
	Cancer metastasis
In-vitro Model	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, UM-UC-3 cells (2 × 10⁶ cells per mouse) stably METTL3 knocked down (shMETTL3-1, shMETTL3-2) were injected into the flanks of mice.

Atherosclerosis [ICD-11: BD40]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	In the in vivo atherosclerosis model,partial ligation of the carotid artery led to plaque formation and up-regulation of METTL3 and NLRP1, with down-regulation of KLF4; knockdown of METTL3 via repetitive shRNA administration prevented the atherogenic process, NLRP1 up-regulation, and Krueppel-like factor 4 (KLF4) down-regulation. Collectively, it has demonstrated that METTL3 serves a central role in the atherogenesis induced by oscillatory stress and disturbed blood flow.
Responsed Disease	Atherosclerosis [ICD-11: BD40.Z]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	MAEC	Normal	Mus musculus	CVCL_U411
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03284		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5C (KDM5C)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00310)

Krueppel-like factor 4 (KLF4)

N6-methyladenosine (m6A)

In total 34 m6A sequence/site(s) in this target gene
mod ID: M6ASITE088979		Click to Show/Hide the Full List
mod site	chr9:107485233-107485234:-		[5]
Sequence	CTTGGTTCTAAAGGTACCAAACAAGGAAGCCAAAGTTTTCA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000374672.5; ENST00000610832.1; ENST00000493306.1; ENST00000497048.5
External Link	RMBase: m6A_site_832383
mod ID: M6ASITE088980		Click to Show/Hide the Full List
mod site	chr9:107485416-107485417:-		[6]
Sequence	CGTGAGTTGGGGGAGGGAAGACCAGAATTCCCTTGAATTGT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000493306.1; ENST00000374672.5; ENST00000497048.5; ENST00000610832.1
External Link	RMBase: m6A_site_832384
mod ID: M6ASITE088981		Click to Show/Hide the Full List
mod site	chr9:107485495-107485496:-		[6]
Sequence	TCCGACTTGAATATTCCTGGACTTACAAAATGCCAAGGGGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000374672.5; ENST00000493306.1; ENST00000610832.1; ENST00000497048.5
External Link	RMBase: m6A_site_832385
mod ID: M6ASITE088982		Click to Show/Hide the Full List
mod site	chr9:107485511-107485512:-		[7]
Sequence	TCATTCCAATTCTAAATCCGACTTGAATATTCCTGGACTTA
Motif Score	3.287565476
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000374672.5; ENST00000610832.1; ENST00000497048.5; ENST00000493306.1
External Link	RMBase: m6A_site_832386
mod ID: M6ASITE088983		Click to Show/Hide the Full List
mod site	chr9:107485560-107485561:-		[6]
Sequence	CAAAAGACAAAAATCAAAGAACAGATGGGGTCTGTGACTGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000493306.1; ENST00000610832.1; ENST00000374672.5
External Link	RMBase: m6A_site_832387
mod ID: M6ASITE088984		Click to Show/Hide the Full List
mod site	chr9:107485574-107485575:-		[6]
Sequence	AAAAATGAGGAATCCAAAAGACAAAAATCAAAGAACAGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000493306.1; ENST00000610832.1; ENST00000497048.5; ENST00000374672.5
External Link	RMBase: m6A_site_832388
mod ID: M6ASITE088985		Click to Show/Hide the Full List
mod site	chr9:107485742-107485743:-		[6]
Sequence	GAGGCATTTTTAAATCCCAGACAGTGGATATGACCCACACT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000374672.5; ENST00000497048.5; ENST00000610832.1; ENST00000493306.1
External Link	RMBase: m6A_site_832389
mod ID: M6ASITE088986		Click to Show/Hide the Full List
mod site	chr9:107485784-107485785:-		[6]
Sequence	CCGAGCATTTTCCAGGTCGGACCACCTCGCCTTACACATGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; hESCs; fibroblasts; H1299; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000493306.1; ENST00000374672.5; ENST00000497048.5; ENST00000610832.1
External Link	RMBase: m6A_site_832390
mod ID: M6ASITE088987		Click to Show/Hide the Full List
mod site	chr9:107485843-107485844:-		[6]
Sequence	CTGACCAGGCACTACCGTAAACACACGGGGCACCGCCCGTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; MM6; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000493306.1; ENST00000374672.5; ENST00000610832.1; ENST00000497048.5
External Link	RMBase: m6A_site_832391
mod ID: M6ASITE088988		Click to Show/Hide the Full List
mod site	chr9:107485864-107485865:-		[6]
Sequence	AAATTCGCCCGCTCAGATGAACTGACCAGGCACTACCGTAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000493306.1; ENST00000610832.1; ENST00000374672.5
External Link	RMBase: m6A_site_832392
mod ID: M6ASITE088989		Click to Show/Hide the Full List
mod site	chr9:107485898-107485899:-		[7]
Sequence	ACCTTACCACTGTGACTGGGACGGCTGTGGATGGAAATTCG
Motif Score	3.616982143
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000610832.1; ENST00000497048.5; ENST00000374672.5; ENST00000493306.1
External Link	RMBase: m6A_site_832393
mod ID: M6ASITE088990		Click to Show/Hide the Full List
mod site	chr9:107485918-107485919:-		[6]
Sequence	TTTACCTTTACAGGTGAGAAACCTTACCACTGTGACTGGGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000493306.1; ENST00000374672.5; ENST00000497048.5
External Link	RMBase: m6A_site_832394
mod ID: M6ASITE088991		Click to Show/Hide the Full List
mod site	chr9:107487036-107487037:-		[6]
Sequence	ATCTCAAGGCACACCTGCGAACCCACACAGGTAGGGGGACA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000497048.5; ENST00000374672.5; ENST00000493306.1
External Link	RMBase: m6A_site_832395
mod ID: M6ASITE088992		Click to Show/Hide the Full List
mod site	chr9:107487075-107487076:-		[6]
Sequence	ATTACGCGGGCTGCGGCAAAACCTACACAAAGAGTTCCCAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000497048.5; ENST00000493306.1; ENST00000374672.5
External Link	RMBase: m6A_site_832396
mod ID: M6ASITE088993		Click to Show/Hide the Full List
mod site	chr9:107487114-107487115:-		[6]
Sequence	GATCGTGGCCCCGGAAAAGGACCGCCACCCACACTTGTGAT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; fibroblasts; MM6; Huh7; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000497048.5; ENST00000493306.1; ENST00000374672.5
External Link	RMBase: m6A_site_832397
mod ID: M6ASITE088994		Click to Show/Hide the Full List
mod site	chr9:107487231-107487232:-		[6]
Sequence	TGTGCTGGCCCCACTTCGGGACACACGGGATGATGCTCACC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; fibroblasts; Huh7; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000493306.1; ENST00000374672.5; ENST00000497048.5
External Link	RMBase: m6A_site_832398
mod ID: M6ASITE088995		Click to Show/Hide the Full List
mod site	chr9:107487407-107487408:-		[6]
Sequence	GGAAGTGCTGAGCAGCAGGGACTGTCACCCTGCCCTGCCGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; fibroblasts; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000374672.5; ENST00000610832.1; ENST00000493306.1
External Link	RMBase: m6A_site_832399
mod ID: M6ASITE088996		Click to Show/Hide the Full List
mod site	chr9:107487450-107487451:-		[6]
Sequence	GGCGGCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTCTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1A; H1B; fibroblasts; MM6; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000610832.1; ENST00000374672.5; ENST00000493306.1
External Link	RMBase: m6A_site_832400
mod ID: M6ASITE088997		Click to Show/Hide the Full List
mod site	chr9:107487520-107487521:-		[6]
Sequence	TGCACCCACTTGGGCGCTGGACCCCCTCTCAGCAATGGCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; MM6; GSC-11; HEK293A-TOA; MSC; iSLK; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000374672.5; ENST00000610832.1; ENST00000493306.1; ENST00000497048.5
External Link	RMBase: m6A_site_832401
mod ID: M6ASITE088998		Click to Show/Hide the Full List
mod site	chr9:107487767-107487768:-		[6]
Sequence	GCTCCTGCGGCCAGAATTGGACCCGGTGTACATTCCGCCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; fibroblasts; MM6; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000493306.1; ENST00000610832.1; ENST00000374672.5; ENST00000411706.1
External Link	RMBase: m6A_site_832402
mod ID: M6ASITE088999		Click to Show/Hide the Full List
mod site	chr9:107487827-107487828:-		[6]
Sequence	GGCTCCCTTCAACCTGGCGGACATCAACGACGTGAGCCCCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; fibroblasts; MM6; CD4T; GSC-11; HEK293A-TOA; MSC; iSLK; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000374672.5; ENST00000411706.1; ENST00000493306.1; ENST00000610832.1
External Link	RMBase: m6A_site_832403
mod ID: M6ASITE089000		Click to Show/Hide the Full List
mod site	chr9:107488076-107488077:-		[6]
Sequence	CAACGATCTCCTGGACCTGGACTTTATTCTCTCCAATTCGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000497048.5; ENST00000411706.1; ENST00000493306.1; ENST00000374672.5
External Link	RMBase: m6A_site_832404
mod ID: M6ASITE089001		Click to Show/Hide the Full List
mod site	chr9:107488082-107488083:-		[6]
Sequence	GGAGTTCAACGATCTCCTGGACCTGGACTTTATTCTCTCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497048.5; ENST00000493306.1; ENST00000411706.1; ENST00000374672.5; ENST00000610832.1
External Link	RMBase: m6A_site_832405
mod ID: M6ASITE089002		Click to Show/Hide the Full List
mod site	chr9:107488107-107488108:-		[6]
Sequence	CGCCCCTACCTCGGAGAGAGACCGAGGAGTTCAACGATCTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; A549; fibroblasts; MM6; HEK293A-TOA; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000497048.5; ENST00000493306.1; ENST00000411706.1; ENST00000374672.5
External Link	RMBase: m6A_site_832406
mod ID: M6ASITE089003		Click to Show/Hide the Full List
mod site	chr9:107488175-107488176:-		[6]
Sequence	GGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; fibroblasts; A549; MM6; HEK293A-TOA; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000374672.5; ENST00000497048.5; ENST00000411706.1; ENST00000610832.1; ENST00000493306.1
External Link	RMBase: m6A_site_832407
mod ID: M6ASITE089004		Click to Show/Hide the Full List
mod site	chr9:107488304-107488305:-		[6]
Sequence	ATGTCGGGTGGCAACAGGGGACCACCACTGACAGGTCTCTC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000497048.5; ENST00000493306.1; ENST00000610832.1; ENST00000411706.1; ENST00000374672.5
External Link	RMBase: m6A_site_832408
mod ID: M6ASITE089005		Click to Show/Hide the Full List
mod site	chr9:107488958-107488959:-		[8]
Sequence	GCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000610832.1; ENST00000411706.1; ENST00000493306.1; ENST00000374672.5
External Link	RMBase: m6A_site_832409
mod ID: M6ASITE089006		Click to Show/Hide the Full List
mod site	chr9:107489125-107489126:-		[9]
Sequence	GGGAGCAGGGAGGGGTGAGGACCGGTGGGACGCGCCGGAAC
Motif Score	3.622404762
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000374672.5; ENST00000610832.1; ENST00000420475.1; ENST00000493306.1; ENST00000411706.1
External Link	RMBase: m6A_site_832410
mod ID: M6ASITE089007		Click to Show/Hide the Full List
mod site	chr9:107489192-107489193:-		[6]
Sequence	GCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000610832.1; ENST00000374672.5; ENST00000420475.1; ENST00000493306.1
External Link	RMBase: m6A_site_832411
mod ID: M6ASITE089008		Click to Show/Hide the Full List
mod site	chr9:107489335-107489336:-		[6]
Sequence	GAACTTTTGTATACAAAGGAACTTTTTAAAAAAGACGCTTC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000420475.1; ENST00000374672.5; ENST00000610832.1; ENST00000493306.1
External Link	RMBase: m6A_site_832412
mod ID: M6ASITE089009		Click to Show/Hide the Full List
mod site	chr9:107489353-107489354:-		[6]
Sequence	CGTTTACAACTTTTCTAAGAACTTTTGTATACAAAGGAACT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000420475.1; ENST00000374672.5; ENST00000493306.1; ENST00000610832.1
External Link	RMBase: m6A_site_832413
mod ID: M6ASITE089010		Click to Show/Hide the Full List
mod site	chr9:107489408-107489409:-		[6]
Sequence	GAGCGCAGCCCGGCCACCGGACCTACTTACTCGCCTTGCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HEK293A-TOA; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000374672.5; ENST00000610832.1; ENST00000420475.1; ENST00000493306.1
External Link	RMBase: m6A_site_832414
mod ID: M6ASITE089011		Click to Show/Hide the Full List
mod site	chr9:107490139-107490140:-		[6]
Sequence	CCAGTCTTCGCGGGCTTCGAACCCAGGGAGCCGACAATGGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; A549; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000420475.1
External Link	RMBase: m6A_site_832415
mod ID: M6ASITE089012		Click to Show/Hide the Full List
mod site	chr9:107490224-107490225:-		[6]
Sequence	CGCTCTTCTCCAGCGCGCAGACAGCGCGGCAAGCGCGTATG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000420475.1
External Link	RMBase: m6A_site_832416

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000119		Click to Show/Hide the Full List
mod site	chr9:107489438-107489439:-		[10]
Sequence	CAGTGGTGGGGGACGCTGCTGAGTGGAAGAGAGCGCAGCCC
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000374672.5; ENST00000610832.1; ENST00000420475.1
External Link	RMBase: m7G_site_867

Ref 1	MicroRNA-1915-3p inhibits cell migration and invasion by targeting SET in non-small-cell lung cancer. BMC Cancer. 2021 Nov 13;21(1):1218. doi: 10.1186/s12885-021-08961-8.
Ref 2	METTL3/YTHDF2 m(6) A axis promotes tumorigenesis by degrading SETD7 and KLF4 mRNAs in bladder cancer. J Cell Mol Med. 2020 Apr;24(7):4092-4104. doi: 10.1111/jcmm.15063. Epub 2020 Mar 3.
Ref 3	Methyl CpG binding protein 2 promotes colorectal cancer metastasis by regulating N(6) -methyladenosine methylation through methyltransferase-like 14. Cancer Sci. 2021 Aug;112(8):3243-3254. doi: 10.1111/cas.15011. Epub 2021 Jun 29.
Ref 4	METTL3-dependent N(6)-methyladenosine RNA modification mediates the atherogenic inflammatory cascades in vascular endothelium. Proc Natl Acad Sci U S A. 2021 Feb 16;118(7):e2025070118. doi: 10.1073/pnas.2025070118.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 8	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 9	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 10	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map