m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00306)
Target Name Kelch-like ECH-associated protein 1 (KEAP1)
Synonyms
Cytosolic inhibitor of Nrf2; INrf2; Kelch-like protein 19; INRF2; KIAA0132; KLHL19
    Click to Show/Hide
Gene Name KEAP1
Chromosomal Location 19p13.2
Family KEAP1 family
Function
Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex that regulates the response to oxidative stress by targeting NFE2L2/NRF2 for ubiquitination. KEAP1 acts as a key sensor of oxidative and electrophilic stress: in normal conditions, the BCR(KEAP1) complex mediates ubiquitination and degradation of NFE2L2/NRF2, a transcription factor regulating expression of many cytoprotective genes. In response to oxidative stress, different electrophile metabolites trigger non-enzymatic covalent modifications of highly reactive cysteine residues in KEAP1, leading to inactivate the ubiquitin ligase activity of the BCR(KEAP1) complex, promoting NFE2L2/NRF2 nuclear accumulation and expression of phase II detoxifying enzymes. In response to selective autophagy, KEAP1 is sequestered in inclusion bodies following its interaction with SQSTM1/p62, leading to inactivation of the BCR(KEAP1) complex and activation of NFE2L2/NRF2 . The BCR(KEAP1) complex also mediates ubiquitination of SQSTM1/p62, increasing SQSTM1/p62 sequestering activity and degradation. The BCR(KEAP1) complex also targets BPTF and PGAM5 for ubiquitination and degradation by the proteasome.
    Click to Show/Hide
Gene ID 9817
Uniprot ID
KEAP1_HUMAN
HGNC ID
HGNC:23177
KEGG ID
hsa:9817
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
KEAP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line HeLa cell line Homo sapiens
Treatment: METTL3 knockdown HeLa cells
Control: HeLa cells
 GSE70061
Regulation
logFC: -1.79E+00
p-value: 1.23E-03
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between KEAP1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 1.17E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A methylation was involved in oxidative stress-mediated apoptosis in the mechanism of colistin nephrotoxicity. METTL3-mediated m6A methylation modification is involved in colistin-induced nephrotoxicity through apoptosis mediated by Kelch-like ECH-associated protein 1 (KEAP1)/Nrf2 signaling pathway.
Target Regulation Down regulation
Responsed Disease Diseases of the urinary system ICD-11: GC2Z
 Disease Info 
Responsed Drug Colistin Approved
 Drug Info 
Cell Process Oxidative stress
Cell apoptosis
In-vivo Model The 60 female Kunming mice were divided into two groups (n = 30): control group (injection of physiological saline through the caudal vein) and colistin group (injection of 15 mg/kg colistin, twice a day, with an eight-hour interval).
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1
Cell Line AGS cell line Homo sapiens
Treatment: shYTHDF1 AGS
Control: shControl AGS
 GSE159425
Regulation
logFC: 1.01E+00
p-value: 4.73E-09
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between KEAP1 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.61E+00 GSE63591
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Kelch-like ECH-associated protein 1 (KEAP1)-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Responsed Drug Cisplatin Approved
 Drug Info 
Pathway Response Chemical carcinogenesis - reactive oxygen species hsa05208
Cell cycle hsa04110
Cell Process Biological regulation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
GLC-82 Endocervical adenocarcinoma Homo sapiens CVCL_3371
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
HEK293T Normal Homo sapiens CVCL_0063
NCI-H1650 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1483
NCI-H838 Lung adenocarcinoma Homo sapiens CVCL_1594
SPC-A1 Endocervical adenocarcinoma Homo sapiens CVCL_6955
In-vivo Model Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 106 p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Kelch-like ECH-associated protein 1 (KEAP1)-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Cisplatin Approved
 Drug Info 
Pathway Response Chemical carcinogenesis - reactive oxygen species hsa05208
Cell cycle hsa04110
Cell Process Biological regulation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
GLC-82 Endocervical adenocarcinoma Homo sapiens CVCL_3371
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
HEK293T Normal Homo sapiens CVCL_0063
NCI-H1650 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1483
NCI-H838 Lung adenocarcinoma Homo sapiens CVCL_1594
SPC-A1 Endocervical adenocarcinoma Homo sapiens CVCL_6955
In-vivo Model Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 106 p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.
Diseases of the urinary system [ICD-11: GC2Z]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A methylation was involved in oxidative stress-mediated apoptosis in the mechanism of colistin nephrotoxicity. METTL3-mediated m6A methylation modification is involved in colistin-induced nephrotoxicity through apoptosis mediated by Kelch-like ECH-associated protein 1 (KEAP1)/Nrf2 signaling pathway.
Responsed Disease Diseases of the urinary system [ICD-11: GC2Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Colistin Approved
 Drug Info 
Cell Process Oxidative stress
Cell apoptosis
In-vivo Model The 60 female Kunming mice were divided into two groups (n = 30): control group (injection of physiological saline through the caudal vein) and colistin group (injection of 15 mg/kg colistin, twice a day, with an eight-hour interval).
Cisplatin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary YTHDF1 deficiency inhibits Non-small cell lung cancer cell proliferation and xenograft tumor formation through regulating the translational efficiency of CDK2, CDK4, p27, and cyclin D1, and that YTHDF1 depletion restrains de novo lung adenocarcinomas (ADC) progression. Mechanistic studies identified the Kelch-like ECH-associated protein 1 (KEAP1)-Nrf2-AKR1C1 axis as the downstream mediator of YTHDF1. YTHDF1 high expression correlates with better clinical outcome, with its depletion rendering cancerous cells resistant to cisplatin (DDP) treatment.
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response Chemical carcinogenesis - reactive oxygen species hsa05208
Cell cycle hsa04110
Cell Process Biological regulation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
A549-DDP (Human lung adenocarcinoma is resistant to cisplatin)
GLC-82 Endocervical adenocarcinoma Homo sapiens CVCL_3371
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
HEK293T Normal Homo sapiens CVCL_0063
NCI-H1650 Minimally invasive lung adenocarcinoma Homo sapiens CVCL_1483
NCI-H838 Lung adenocarcinoma Homo sapiens CVCL_1594
SPC-A1 Endocervical adenocarcinoma Homo sapiens CVCL_6955
In-vivo Model Mice were treated via nasal inhalation of adenovirus carrying Cre recombinase (5 × 106 p.f.u for Ad-Cre, Biowit Inc., Shenzhen, Guangdong), and were then killed at indicated times for gross inspection and histopathological examination.
Colistin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary m6A methylation was involved in oxidative stress-mediated apoptosis in the mechanism of colistin nephrotoxicity. METTL3-mediated m6A methylation modification is involved in colistin-induced nephrotoxicity through apoptosis mediated by Kelch-like ECH-associated protein 1 (KEAP1)/Nrf2 signaling pathway.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Diseases of the urinary system ICD-11: GC2Z
 Disease Info 
Cell Process Oxidative stress
Cell apoptosis
In-vivo Model The 60 female Kunming mice were divided into two groups (n = 30): control group (injection of physiological saline through the caudal vein) and colistin group (injection of 15 mg/kg colistin, twice a day, with an eight-hour interval).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00306)
Kelch-like ECH-associated protein 1 (KEAP1)
Adenosine-to-Inosine editing (A-to-I)
In total 13 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008992 Click to Show/Hide the Full List
mod site chr19:10490493-10490494:- [3]
Sequence GGCGAAACCCAATTTCTACTAAAAATACAAAAATTAGCCGG
Transcript ID List ENST00000590593.1; ENST00000393623.6; ENST00000592478.5; ENST00000592671.1; ENST00000171111.10; rmsk_4936479
External Link RMBase: RNA-editing_site_65742
mod ID: A2ISITE008993 Click to Show/Hide the Full List
mod site chr19:10500747-10500748:- [4]
Sequence GGCGGAGGTTGCAGTGAGCCAAGATCGAGCCATTGCACTCC
Transcript ID List ENST00000393623.6; ENST00000591419.2; ENST00000591039.1; ENST00000585845.1; rmsk_4936513; ENST00000592055.2; ENST00000171111.10
External Link RMBase: RNA-editing_site_65743
mod ID: A2ISITE008994 Click to Show/Hide the Full List
mod site chr19:10500775-10500776:- [4]
Sequence GAGGCAGGAGGATCGCTTGAACCCGGGAGGCGGAGGTTGCA
Transcript ID List ENST00000393623.6; rmsk_4936513; ENST00000592055.2; ENST00000591419.2; ENST00000585845.1; ENST00000591039.1; ENST00000171111.10
External Link RMBase: RNA-editing_site_65744
mod ID: A2ISITE008995 Click to Show/Hide the Full List
mod site chr19:10500790-10500791:- [4]
Sequence GCTACTCGGGAGGCTGAGGCAGGAGGATCGCTTGAACCCGG
Transcript ID List ENST00000393623.6; ENST00000585845.1; ENST00000591419.2; ENST00000592055.2; rmsk_4936513; ENST00000171111.10; ENST00000591039.1
External Link RMBase: RNA-editing_site_65745
mod ID: A2ISITE008996 Click to Show/Hide the Full List
mod site chr19:10500807-10500808:- [4]
Sequence GGACGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGA
Transcript ID List rmsk_4936513; ENST00000171111.10; ENST00000591419.2; ENST00000393623.6; ENST00000585845.1; ENST00000591039.1; ENST00000592055.2
External Link RMBase: RNA-editing_site_65746
mod ID: A2ISITE008997 Click to Show/Hide the Full List
mod site chr19:10500817-10500818:- [4]
Sequence GTGTGGTGGCGGACGCCTGTAGTCCCAGCTACTCGGGAGGC
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000591039.1; ENST00000592055.2; ENST00000393623.6; rmsk_4936513; ENST00000591419.2
External Link RMBase: RNA-editing_site_65747
mod ID: A2ISITE008998 Click to Show/Hide the Full List
mod site chr19:10500872-10500873:- [4]
Sequence AGCCTGGCCAACATGGCGAAACCCAGTCTCTGCTAAAAATA
Transcript ID List ENST00000592055.2; ENST00000591419.2; ENST00000591039.1; ENST00000585845.1; ENST00000171111.10; rmsk_4936513; ENST00000393623.6
External Link RMBase: RNA-editing_site_65748
mod ID: A2ISITE008999 Click to Show/Hide the Full List
mod site chr19:10500873-10500874:- [4]
Sequence CAGCCTGGCCAACATGGCGAAACCCAGTCTCTGCTAAAAAT
Transcript ID List ENST00000591039.1; ENST00000591419.2; rmsk_4936513; ENST00000592055.2; ENST00000171111.10; ENST00000393623.6; ENST00000585845.1
External Link RMBase: RNA-editing_site_65749
mod ID: A2ISITE009000 Click to Show/Hide the Full List
mod site chr19:10500882-10500883:- [4]
Sequence GTTTGAGACCAGCCTGGCCAACATGGCGAAACCCAGTCTCT
Transcript ID List ENST00000171111.10; ENST00000585845.1; ENST00000591419.2; rmsk_4936513; ENST00000393623.6; ENST00000592055.2; ENST00000591039.1
External Link RMBase: RNA-editing_site_65750
mod ID: A2ISITE009001 Click to Show/Hide the Full List
mod site chr19:10500906-10500907:- [4]
Sequence CGGGCGGCTCACTTGAGGTCAGGAGTTTGAGACCAGCCTGG
Transcript ID List rmsk_4936513; ENST00000585845.1; ENST00000393623.6; ENST00000171111.10; ENST00000592055.2; ENST00000591039.1; ENST00000591419.2
External Link RMBase: RNA-editing_site_65751
mod ID: A2ISITE009002 Click to Show/Hide the Full List
mod site chr19:10500930-10500931:- [4]
Sequence TCCCAGCACTTCGGGATGCCAAGGCGGGCGGCTCACTTGAG
Transcript ID List ENST00000591039.1; ENST00000393623.6; ENST00000171111.10; rmsk_4936513; ENST00000585845.1; ENST00000591419.2; ENST00000592055.2
External Link RMBase: RNA-editing_site_65752
mod ID: A2ISITE009003 Click to Show/Hide the Full List
mod site chr19:10500970-10500971:- [4]
Sequence AACTGCACCCCGGGTCAGGCATGGTGGCTTACGCCTGTAAT
Transcript ID List ENST00000592055.2; ENST00000393623.6; ENST00000591039.1; ENST00000585845.1; ENST00000591419.2; ENST00000171111.10; rmsk_4936513
External Link RMBase: RNA-editing_site_65753
mod ID: A2ISITE009004 Click to Show/Hide the Full List
mod site chr19:10500974-10500975:- [4]
Sequence AAAAAACTGCACCCCGGGTCAGGCATGGTGGCTTACGCCTG
Transcript ID List ENST00000591039.1; ENST00000585845.1; ENST00000591419.2; ENST00000171111.10; rmsk_4936513; ENST00000393623.6; ENST00000592055.2
External Link RMBase: RNA-editing_site_65754
5-methylcytidine (m5C)
In total 7 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001771 Click to Show/Hide the Full List
mod site chr19:10503138-10503139:-
Sequence GAGCCCCTGCGCGCCCCGGCCATCCCCACCCCGAGGGACCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000585845.1; ENST00000592055.2; ENST00000171111.10
External Link RMBase: m5C_site_22614
mod ID: M5CSITE001772 Click to Show/Hide the Full List
mod site chr19:10503139-10503140:-
Sequence GGAGCCCCTGCGCGCCCCGGCCATCCCCACCCCGAGGGACC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000592055.2
External Link RMBase: m5C_site_22615
mod ID: M5CSITE001773 Click to Show/Hide the Full List
mod site chr19:10503142-10503143:-
Sequence CCCGGAGCCCCTGCGCGCCCCGGCCATCCCCACCCCGAGGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000592055.2
External Link RMBase: m5C_site_22616
mod ID: M5CSITE001774 Click to Show/Hide the Full List
mod site chr19:10503143-10503144:-
Sequence GCCCGGAGCCCCTGCGCGCCCCGGCCATCCCCACCCCGAGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000585845.1; ENST00000592055.2; ENST00000171111.10
External Link RMBase: m5C_site_22617
mod ID: M5CSITE001775 Click to Show/Hide the Full List
mod site chr19:10503144-10503145:-
Sequence TGCCCGGAGCCCCTGCGCGCCCCGGCCATCCCCACCCCGAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000592055.2; ENST00000585845.1; ENST00000171111.10
External Link RMBase: m5C_site_22618
mod ID: M5CSITE001776 Click to Show/Hide the Full List
mod site chr19:10503145-10503146:-
Sequence GTGCCCGGAGCCCCTGCGCGCCCCGGCCATCCCCACCCCGA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000171111.10; ENST00000585845.1; ENST00000592055.2
External Link RMBase: m5C_site_22619
mod ID: M5CSITE001777 Click to Show/Hide the Full List
mod site chr19:10503147-10503148:-
Sequence CTGTGCCCGGAGCCCCTGCGCGCCCCGGCCATCCCCACCCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000592055.2
External Link RMBase: m5C_site_22620
N6-methyladenosine (m6A)
In total 59 m6A sequence/site(s) in this target gene
mod ID: M6ASITE039741 Click to Show/Hide the Full List
mod site chr19:10486137-10486138:- [5]
Sequence GGAAAATAAAGAACAGACTAACTAGTGTCTTTCACCCTGGC
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419063
mod ID: M6ASITE039742 Click to Show/Hide the Full List
mod site chr19:10486145-10486146:- [5]
Sequence TTTTCCAAGGAAAATAAAGAACAGACTAACTAGTGTCTTTC
Motif Score 2.951386905
Cell/Tissue List HEK293T; A549; H1299; Huh7
Seq Type List MeRIP-seq; DART-seq; m6A-seq
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419064
mod ID: M6ASITE039743 Click to Show/Hide the Full List
mod site chr19:10486196-10486197:- [6]
Sequence GGCACTTCCCCACCGGATGGACAGTTATTTTGTTGATAAGT
Motif Score 3.643047619
Cell/Tissue List HEK293T; A549; hESC-HEK293T; hNPCs; Huh7; NB4
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000592478.5; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419065
mod ID: M6ASITE039744 Click to Show/Hide the Full List
mod site chr19:10486383-10486384:- [7]
Sequence TCCAGGAGAGAGGCCCCCAAACCCTCTGGCCGGGTAATAGG
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000592478.5; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419066
mod ID: M6ASITE039745 Click to Show/Hide the Full List
mod site chr19:10486442-10486443:- [7]
Sequence GAGCCCCGGGAGTGTCCAAGACAGCCTGGCTGGGAAAGGGG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000592478.5; ENST00000171111.10; ENST00000393623.6
External Link RMBase: m6A_site_419067
mod ID: M6ASITE039746 Click to Show/Hide the Full List
mod site chr19:10486507-10486508:- [5]
Sequence GATGCCTCAGTGTTAAAATGACATCTCAAAAGAAGTCCAAA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000592478.5; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419068
mod ID: M6ASITE039747 Click to Show/Hide the Full List
mod site chr19:10486563-10486564:- [5]
Sequence GGACTAAAAGAAAAGACAGCACTGCAAATAACCCATCTTCC
Motif Score 3.252583333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000171111.10; ENST00000592478.5; ENST00000393623.6
External Link RMBase: m6A_site_419069
mod ID: M6ASITE039748 Click to Show/Hide the Full List
mod site chr19:10486568-10486569:- [7]
Sequence AACCGGGACTAAAAGAAAAGACAGCACTGCAAATAACCCAT
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; brain; kidney; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419070
mod ID: M6ASITE039749 Click to Show/Hide the Full List
mod site chr19:10486581-10486582:- [7]
Sequence GTTTTTGTACAAAAACCGGGACTAAAAGAAAAGACAGCACT
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419071
mod ID: M6ASITE039750 Click to Show/Hide the Full List
mod site chr19:10486587-10486588:- [7]
Sequence ATCATTGTTTTTGTACAAAAACCGGGACTAAAAGAAAAGAC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000171111.10; ENST00000592478.5; ENST00000393623.6
External Link RMBase: m6A_site_419072
mod ID: M6ASITE039751 Click to Show/Hide the Full List
mod site chr19:10486593-10486594:- [5]
Sequence GGGAGTATCATTGTTTTTGTACAAAAACCGGGACTAAAAGA
Motif Score 2.856142857
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419073
mod ID: M6ASITE039752 Click to Show/Hide the Full List
mod site chr19:10486624-10486625:- [5]
Sequence TTTGTTTCTTGGGCAAAAATACAGTCCAATGGGGAGTATCA
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000592478.5; ENST00000393623.6; ENST00000171111.10; ENST00000590237.1
External Link RMBase: m6A_site_419074
mod ID: M6ASITE039753 Click to Show/Hide the Full List
mod site chr19:10486664-10486665:- [7]
Sequence GAAGCAGATTGACCAGCAGAACTGTACCTGTTGAGGCACTT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000592478.5; ENST00000171111.10; ENST00000393623.6; ENST00000590237.1
External Link RMBase: m6A_site_419075
mod ID: M6ASITE039754 Click to Show/Hide the Full List
mod site chr19:10486673-10486674:- [8]
Sequence GCCCTGCCGGAAGCAGATTGACCAGCAGAACTGTACCTGTT
Motif Score 2.839113095
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000590237.1; ENST00000592478.5; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419076
mod ID: M6ASITE039755 Click to Show/Hide the Full List
mod site chr19:10486734-10486735:- [5]
Sequence GGAGCGAGGTGACCCGAATGACATCGGGCCGGAGTGGGGTG
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000171111.10; ENST00000590237.1; ENST00000590593.1; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419077
mod ID: M6ASITE039756 Click to Show/Hide the Full List
mod site chr19:10486760-10486761:- [7]
Sequence GTGTTACGACCCAGATACAGACACCTGGAGCGAGGTGACCC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000590593.1; ENST00000393623.6; ENST00000590237.1; ENST00000592478.5; ENST00000171111.10
External Link RMBase: m6A_site_419078
mod ID: M6ASITE039757 Click to Show/Hide the Full List
mod site chr19:10486790-10486791:- [7]
Sequence TGATGGTCACACGTTCCTGGACAGTGTGGAGTGTTACGACC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; hESCs; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000393623.6; ENST00000171111.10; ENST00000592478.5; ENST00000590593.1; ENST00000590237.1
External Link RMBase: m6A_site_419079
mod ID: M6ASITE039758 Click to Show/Hide the Full List
mod site chr19:10486802-10486803:- [9]
Sequence CGCAGGAGGCTATGATGGTCACACGTTCCTGGACAGTGTGG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000393623.6; ENST00000592478.5; ENST00000171111.10; ENST00000590237.1; ENST00000590593.1
External Link RMBase: m6A_site_419080
mod ID: M6ASITE039759 Click to Show/Hide the Full List
mod site chr19:10489221-10489222:- [5]
Sequence GGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATC
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000590593.1; ENST00000592478.5; ENST00000590237.1; ENST00000171111.10; ENST00000393623.6
External Link RMBase: m6A_site_419081
mod ID: M6ASITE039760 Click to Show/Hide the Full List
mod site chr19:10489266-10489267:- [7]
Sequence ATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; U2OS; MM6; Huh7; CD4T; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000393623.6; ENST00000592478.5; ENST00000171111.10; ENST00000590237.1; ENST00000590593.1
External Link RMBase: m6A_site_419082
mod ID: M6ASITE039761 Click to Show/Hide the Full List
mod site chr19:10489278-10489279:- [10]
Sequence TGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTA
Motif Score 2.20572619
Cell/Tissue List HepG2; U2OS; Huh7; peripheral-blood; endometrial; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000171111.10; ENST00000592478.5; ENST00000590593.1; ENST00000590237.1; ENST00000393623.6
External Link RMBase: m6A_site_419083
mod ID: M6ASITE039762 Click to Show/Hide the Full List
mod site chr19:10489304-10489305:- [11]
Sequence TGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATG
Motif Score 2.951386905
Cell/Tissue List brain; U2OS; Huh7; peripheral-blood; NB4; MM6
Seq Type List m6A-REF-seq; MeRIP-seq; m6A-seq
Transcript ID List ENST00000393623.6; ENST00000171111.10; ENST00000590237.1; ENST00000592478.5; ENST00000590593.1
External Link RMBase: m6A_site_419084
mod ID: M6ASITE039763 Click to Show/Hide the Full List
mod site chr19:10489313-10489314:- [12]
Sequence TGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGC
Motif Score 3.622404762
Cell/Tissue List U2OS; Huh7; peripheral-blood; NB4; MM6
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000590237.1; ENST00000171111.10; ENST00000592478.5; ENST00000590593.1; ENST00000393623.6
External Link RMBase: m6A_site_419085
mod ID: M6ASITE039764 Click to Show/Hide the Full List
mod site chr19:10489352-10489353:- [9]
Sequence TTTAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000590237.1; ENST00000592478.5; ENST00000171111.10; ENST00000590593.1; ENST00000393623.6
External Link RMBase: m6A_site_419086
mod ID: M6ASITE039765 Click to Show/Hide the Full List
mod site chr19:10489404-10489405:- [13]
Sequence GCTGGGGTTCCCAAAGCCAGACCCCCAGAGTCACCTTCTCT
Motif Score 2.876744048
Cell/Tissue List MT4; Huh7; peripheral-blood; NB4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000393623.6; ENST00000590593.1; ENST00000592478.5; ENST00000590237.1; ENST00000171111.10
External Link RMBase: m6A_site_419087
mod ID: M6ASITE039766 Click to Show/Hide the Full List
mod site chr19:10489667-10489668:- [13]
Sequence GCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAG
Motif Score 2.951386905
Cell/Tissue List MT4; Huh7; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000590593.1; ENST00000171111.10; ENST00000592478.5; ENST00000393623.6
External Link RMBase: m6A_site_419088
mod ID: M6ASITE039767 Click to Show/Hide the Full List
mod site chr19:10489737-10489738:- [14]
Sequence CCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCT
Motif Score 3.643047619
Cell/Tissue List HepG2; hESC-HEK293T; HeLa; MT4; MM6; Huh7; CD4T; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000590593.1; ENST00000171111.10; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419089
mod ID: M6ASITE039768 Click to Show/Hide the Full List
mod site chr19:10489806-10489807:- [5]
Sequence ACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGC
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000592478.5; ENST00000590593.1; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419090
mod ID: M6ASITE039769 Click to Show/Hide the Full List
mod site chr19:10491630-10491631:- [11]
Sequence GGTGGGGGTCATCGATGGCCACATCTATGCCGTCGGCGGCT
Motif Score 2.053113095
Cell/Tissue List brain; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000393623.6; ENST00000171111.10; ENST00000590593.1; ENST00000592478.5
External Link RMBase: m6A_site_419091
mod ID: M6ASITE039770 Click to Show/Hide the Full List
mod site chr19:10491714-10491715:- [5]
Sequence CTCCAGCGCCCTGGACTGTTACAACCCCATGACCAATCAGT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000171111.10; ENST00000590593.1; ENST00000393623.6; ENST00000592478.5
External Link RMBase: m6A_site_419092
mod ID: M6ASITE039771 Click to Show/Hide the Full List
mod site chr19:10491720-10491721:- [7]
Sequence CACCGACTCCAGCGCCCTGGACTGTTACAACCCCATGACCA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; HEK293T; H1B; hESCs; fibroblasts; CD8T; MT4; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000590593.1
External Link RMBase: m6A_site_419093
mod ID: M6ASITE039772 Click to Show/Hide the Full List
mod site chr19:10491747-10491748:- [8]
Sequence CGGCAGGAACAACTCGCCCGACGGCAACACCGACTCCAGCG
Motif Score 2.839505952
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000171111.10; ENST00000393623.6; ENST00000590593.1
External Link RMBase: m6A_site_419094
mod ID: M6ASITE039773 Click to Show/Hide the Full List
mod site chr19:10491759-10491760:- [7]
Sequence GTACGCCGTGGGCGGCAGGAACAACTCGCCCGACGGCAACA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; hESC-HEK293T; H1B; hESCs; fibroblasts; MT4; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000590593.1; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419095
mod ID: M6ASITE039774 Click to Show/Hide the Full List
mod site chr19:10491777-10491778:- [5]
Sequence CGTGGTGGGCGGGCTGTTGTACGCCGTGGGCGGCAGGAACA
Motif Score 2.830077381
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000590593.1; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419096
mod ID: M6ASITE039775 Click to Show/Hide the Full List
mod site chr19:10491831-10491832:- [7]
Sequence CACCTGGCTCCGGTTGGCGGACCTGCAGGTGCCGCGGAGCG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; H1B; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000393623.6; ENST00000590593.1; ENST00000171111.10
External Link RMBase: m6A_site_419097
mod ID: M6ASITE039776 Click to Show/Hide the Full List
mod site chr19:10491867-10491868:- [9]
Sequence GCTCAGCTACCTGGAGGCTTACAACCCCAGTGACGGCACCT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000590593.1; ENST00000393623.6; ENST00000171111.10
External Link RMBase: m6A_site_419098
mod ID: M6ASITE039777 Click to Show/Hide the Full List
mod site chr19:10491893-10491894:- [11]
Sequence ACCGCGGGCGGCTACTTCCGACAGTCGCTCAGCTACCTGGA
Motif Score 2.865571429
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000171111.10; ENST00000393623.6
External Link RMBase: m6A_site_419099
mod ID: M6ASITE039778 Click to Show/Hide the Full List
mod site chr19:10491915-10491916:- [9]
Sequence CAAGGTGGGCCGCCTGATCTACACCGCGGGCGGCTACTTCC
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000171111.10; ENST00000393623.6
External Link RMBase: m6A_site_419100
mod ID: M6ASITE039779 Click to Show/Hide the Full List
mod site chr19:10491969-10491970:- [11]
Sequence CTTCGAGGAGCTCACCCTGCACAAGCCCACGCAGGTGATGC
Motif Score 2.830589286
Cell/Tissue List brain; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000171111.10; ENST00000588024.1; ENST00000393623.6
External Link RMBase: m6A_site_419101
mod ID: M6ASITE039780 Click to Show/Hide the Full List
mod site chr19:10492005-10492006:- [7]
Sequence GTCCGACTCCCGCTGCAAGGACTACCTGGTCAAGATCTTCG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; H1A; H1B; A549; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List ENST00000585845.1; ENST00000588024.1; ENST00000171111.10; ENST00000393623.6
External Link RMBase: m6A_site_419102
mod ID: M6ASITE039781 Click to Show/Hide the Full List
mod site chr19:10492065-10492066:- [7]
Sequence CTGCCACTCGTTGACGCCGAACTTCCTGCAGATGCAGCTGC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; H1B; A549; MM6; peripheral-blood; GSC-11; HEK293T; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000585845.1; ENST00000588024.1; ENST00000393623.6; ENST00000171111.10; ENST00000592055.2
External Link RMBase: m6A_site_419103
mod ID: M6ASITE039782 Click to Show/Hide the Full List
mod site chr19:10492127-10492128:- [7]
Sequence TGGGTCAAGTACGACTGCGAACAGCGACGGTTCTACGTCCA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; MM6; peripheral-blood; GSC-11; HEK293T; endometrial; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000588024.1; ENST00000393623.6; ENST00000592055.2
External Link RMBase: m6A_site_419104
mod ID: M6ASITE039783 Click to Show/Hide the Full List
mod site chr19:10492598-10492599:- [10]
Sequence CAGCCTCCCGAGTAGCTGGGACTAGAGGCGTGTGCCACCAC
Motif Score 4.065041667
Cell/Tissue List HepG2; HeLa; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000592055.2; ENST00000393623.6; ENST00000588024.1
External Link RMBase: m6A_site_419105
mod ID: M6ASITE039784 Click to Show/Hide the Full List
mod site chr19:10499410-10499411:- [9]
Sequence GCGTGCCCGGGAGTACATCTACATGCATTTTGGGGAGGTGA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000585845.1; ENST00000588024.1; ENST00000591419.2; ENST00000592055.2; ENST00000171111.10; ENST00000393623.6; ENST00000591039.1
External Link RMBase: m6A_site_419106
mod ID: M6ASITE039785 Click to Show/Hide the Full List
mod site chr19:10499416-10499417:- [9]
Sequence GCACCAGCGTGCCCGGGAGTACATCTACATGCATTTTGGGG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000591419.2; ENST00000393623.6; ENST00000588024.1; ENST00000171111.10; ENST00000592055.2; ENST00000585845.1; ENST00000591039.1
External Link RMBase: m6A_site_419107
mod ID: M6ASITE039786 Click to Show/Hide the Full List
mod site chr19:10499494-10499495:- [7]
Sequence CTTCCTGGTGCAGCAGCTGGACCCCAGCAATGCCATCGGCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000591419.2; ENST00000588024.1; ENST00000585845.1; ENST00000393623.6; ENST00000591039.1; ENST00000171111.10; ENST00000592055.2
External Link RMBase: m6A_site_419108
mod ID: M6ASITE039787 Click to Show/Hide the Full List
mod site chr19:10499611-10499612:- [9]
Sequence GCGCCTCATTGAATTCGCCTACACGGCCTCCATCTCCATGG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000591419.2; ENST00000171111.10; ENST00000591039.1; ENST00000592055.2; ENST00000585845.1; ENST00000393623.6
External Link RMBase: m6A_site_419109
mod ID: M6ASITE039788 Click to Show/Hide the Full List
mod site chr19:10499746-10499747:- [9]
Sequence GGCCGCCCAGTTCATGGCCCACAAGGTGGTGCTGGCCTCAT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000591039.1; ENST00000585845.1; ENST00000171111.10; ENST00000393623.6; ENST00000592055.2; ENST00000591419.2
External Link RMBase: m6A_site_419110
mod ID: M6ASITE039789 Click to Show/Hide the Full List
mod site chr19:10499795-10499796:- [9]
Sequence GCCAGCAGCTGTGTGACGTCACACTGCAGGTCAAGTACCAG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000585845.1; ENST00000591039.1; ENST00000171111.10; ENST00000393623.6; ENST00000592055.2; ENST00000591419.2
External Link RMBase: m6A_site_419111
mod ID: M6ASITE039790 Click to Show/Hide the Full List
mod site chr19:10499872-10499873:- [9]
Sequence TGGCAACCGCACCTTCAGCTACACCCTGGAGGATCATACCA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000591039.1; ENST00000592055.2; ENST00000591419.2; ENST00000393623.6; ENST00000585845.1; ENST00000171111.10
External Link RMBase: m6A_site_419112
mod ID: M6ASITE039791 Click to Show/Hide the Full List
mod site chr19:10500037-10500038:- [7]
Sequence GGTGTTGCTTATCTTCTGGAACCCCATGCAGCCAGATCCCA
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000393623.6; ENST00000585845.1; ENST00000171111.10; ENST00000592055.2; ENST00000591419.2; ENST00000591039.1
External Link RMBase: m6A_site_419113
mod ID: M6ASITE039792 Click to Show/Hide the Full List
mod site chr19:10502477-10502478:- [7]
Sequence GGCGGAAACCGAGCGAGAGAACCAGGAGGCGCTGCGCAGAA
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000592055.2; ENST00000591039.1; ENST00000585845.1; ENST00000171111.10; ENST00000591419.2; ENST00000393623.6
External Link RMBase: m6A_site_419114
mod ID: M6ASITE039793 Click to Show/Hide the Full List
mod site chr19:10502490-10502491:- [7]
Sequence GTGGCCCGGGAGCGGCGGAAACCGAGCGAGAGAACCAGGAG
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1; ENST00000591039.1; ENST00000393623.6; ENST00000171111.10; ENST00000591419.2; ENST00000592055.2
External Link RMBase: m6A_site_419115
mod ID: M6ASITE039794 Click to Show/Hide the Full List
mod site chr19:10502573-10502574:- [15]
Sequence CCTCCGAGTTCCCCGCCAGGACTCGGAGGGCCAGGAGGGCG
Motif Score 4.065041667
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000592055.2; ENST00000393623.6; ENST00000591419.2; ENST00000591039.1; ENST00000585845.1; ENST00000171111.10
External Link RMBase: m6A_site_419116
mod ID: M6ASITE039795 Click to Show/Hide the Full List
mod site chr19:10502624-10502625:- [15]
Sequence CCCTGCGGCCGTGCCCGGAGACCAGGAAAACGGGCGCCACG
Motif Score 2.876744048
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000591419.2; ENST00000171111.10; ENST00000591039.1; ENST00000592055.2; ENST00000585845.1; ENST00000393623.6
External Link RMBase: m6A_site_419117
mod ID: M6ASITE039796 Click to Show/Hide the Full List
mod site chr19:10503121-10503122:- [15]
Sequence GGCCATCCCCACCCCGAGGGACCCCCTACGGAGGCGACCTG
Motif Score 3.622404762
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10; ENST00000592055.2
External Link RMBase: m6A_site_419118
mod ID: M6ASITE039797 Click to Show/Hide the Full List
mod site chr19:10503313-10503314:- [7]
Sequence CTCCCCAACCGACAACCAAGACCCCGCAGGCCACGCAGCCC
Motif Score 2.876744048
Cell/Tissue List HeLa; GSC-11; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1; ENST00000171111.10
External Link RMBase: m6A_site_419119
mod ID: M6ASITE039798 Click to Show/Hide the Full List
mod site chr19:10503492-10503493:- [15]
Sequence GAAATCGGGAGATGGAAGGGACAGTGAGAAGGGGGGCCTGG
Motif Score 3.643047619
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1
External Link RMBase: m6A_site_419120
mod ID: M6ASITE039799 Click to Show/Hide the Full List
mod site chr19:10503524-10503525:- [15]
Sequence GCGCGCAGCCCCGCGAGGAGACATCCAGCAACGAAATCGGG
Motif Score 2.897386905
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000585845.1
External Link RMBase: m6A_site_419121
Pseudouridine (Pseudo)
In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000121 Click to Show/Hide the Full List
mod site chr19:10491916-10491917:- [16]
Sequence CCAAGGTGGGCCGCCTGATCTACACCGCGGGCGGCTACTTC
Transcript ID List ENST00000171111.10; ENST00000393623.6
External Link RMBase: Pseudo_site_2430