General Information of the m6A Target Gene (ID: M6ATAR00300)
Target Name Tyrosine-protein kinase JAK3 (JAK3)
Synonyms
Janus kinase 3; JAK-3; Leukocyte janus kinase; L-JAK
    Click to Show/Hide
Gene Name JAK3
Chromosomal Location 19p13.11
Family protein kinase superfamily; Tyr protein kinase family; JAK subfamily
Function
Non-receptor tyrosine kinase involved in various processes such as cell growth, development, or differentiation. Mediates essential signaling events in both innate and adaptive immunity and plays a crucial role in hematopoiesis during T-cells development. In the cytoplasm, plays a pivotal role in signal transduction via its association with type I receptors sharing the common subunit gamma such as IL2R, IL4R, IL7R, IL9R, IL15R and IL21R. Following ligand binding to cell surface receptors, phosphorylates specific tyrosine residues on the cytoplasmic tails of the receptor, creating docking sites for STATs proteins. Subsequently, phosphorylates the STATs proteins once they are recruited to the receptor. Phosphorylated STATs then form homodimer or heterodimers and translocate to the nucleus to activate gene transcription. For example, upon IL2R activation by IL2, JAK1 and JAK3 molecules bind to IL2R beta (IL2RB) and gamma chain (IL2RG) subunits inducing the tyrosine phosphorylation of both receptor subunits on their cytoplasmic domain. Then, STAT5A AND STAT5B are recruited, phosphorylated and activated by JAK1 and JAK3. Once activated, dimerized STAT5 translocates to the nucleus and promotes the transcription of specific target genes in a cytokine-specific fashion.
    Click to Show/Hide
Gene ID 3718
Uniprot ID
JAK3_HUMAN
HGNC ID
HGNC:6193
KEGG ID
hsa:3718
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
JAK3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Wilms tumor 1-associating protein (WTAP) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by WTAP
Cell Line Human umbilical vein endothelial cells Homo sapiens
Treatment: siWTAP HUVECs
Control: siControl HUVECs
GSE167067
Regulation
logFC: 1.47E+00
p-value: 6.40E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary This study established the transcriptional map of m6A in MH7A cells and revealed the potential relationship between RNA methylation modification and rheumatoid arthritis related genes. The results suggested that m6A modification was associated with the occurrence and course of RA to some extent. The validations of WTAP, RIPK2, Tyrosine-protein kinase JAK3 (JAK3) and TNFRSF10A were in accordance with the m6A and RNA sequencing results.
Responsed Disease Rheumatoid arthritis ICD-11: FA20
Pathway Response JAK-STAT signaling pathway hsa04630
Cytokine-cytokine receptor interaction hsa04060
Cell Process Cell proliferation
Cell apoptosis
In-vitro Model MH7A Normal Homo sapiens CVCL_0427
In-vivo Model The rats were adaptively fed for 1 week and then subcutaneous injection of complete Freund's adjuvant into the left hindfoot toe to establish an adjuvant arthritis (AA) rat model. After induction of the immune response for 20 days, all rats were anesthetized by the intraperitoneal injection of 1% sodium pentobarbital (60 mg/kg) and sacrificed by exsanguination of the abdominal aorta.
Rheumatoid arthritis [ICD-11: FA20]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary This study established the transcriptional map of m6A in MH7A cells and revealed the potential relationship between RNA methylation modification and rheumatoid arthritis related genes. The results suggested that m6A modification was associated with the occurrence and course of RA to some extent. The validations of WTAP, RIPK2, Tyrosine-protein kinase JAK3 (JAK3) and TNFRSF10A were in accordance with the m6A and RNA sequencing results.
Responsed Disease Rheumatoid arthritis [ICD-11: FA20]
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
Pathway Response JAK-STAT signaling pathway hsa04630
Cytokine-cytokine receptor interaction hsa04060
Cell Process Cell proliferation
Cell apoptosis
In-vitro Model MH7A Normal Homo sapiens CVCL_0427
In-vivo Model The rats were adaptively fed for 1 week and then subcutaneous injection of complete Freund's adjuvant into the left hindfoot toe to establish an adjuvant arthritis (AA) rat model. After induction of the immune response for 20 days, all rats were anesthetized by the intraperitoneal injection of 1% sodium pentobarbital (60 mg/kg) and sacrificed by exsanguination of the abdominal aorta.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00300)
Tyrosine-protein kinase JAK3 (JAK3)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009105 Click to Show/Hide the Full List
mod site chr19:17826378-17826379:- [2]
Sequence TTTATTTTTATTTTTGAGACAGAGCCTCGCTCTGTTACCCA
Transcript ID List ENST00000527031.5; ENST00000527670.5; ENST00000458235.5
External Link RMBase: RNA-editing_site_67647
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001846 Click to Show/Hide the Full List
mod site chr19:17826886-17826887:- [3]
Sequence CACGAGCTCATGAAGCTGTGCTGGGCCCCTAGCCCACAGGA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000527031.5; ENST00000458235.5; ENST00000527670.5
External Link RMBase: m5C_site_23557
mod ID: M5CSITE001847 Click to Show/Hide the Full List
mod site chr19:17831349-17831350:- [3]
Sequence GTGCACCGCGACCTGGCCGCCCGAAACATCCTCGTGGAGAG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000534444.1; ENST00000527031.5; ENST00000458235.5; ENST00000527670.5
External Link RMBase: m5C_site_23558
N6-methyladenosine (m6A)
In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE040472 Click to Show/Hide the Full List
mod site chr19:17826728-17826729:- [4]
Sequence TTCATAGCTCCTGCCCGCAGACCTCTGGATTAGGTCTCTGT
Motif Score 2.876744048
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000527670.5; rmsk_4957080; ENST00000458235.5
External Link RMBase: m6A_site_428068
mod ID: M6ASITE040473 Click to Show/Hide the Full List
mod site chr19:17826766-17826767:- [4]
Sequence ACTGCTCACCCAGAGGGCAAACACCACTCCCTGTCCTTTTC
Motif Score 2.20572619
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000527670.5; ENST00000458235.5
External Link RMBase: m6A_site_428069
mod ID: M6ASITE040475 Click to Show/Hide the Full List
mod site chr19:17826798-17826799:- [4]
Sequence GCGGAAGCCGGGGGTGTGAGACTCATGCCTTCACTGCTCAC
Motif Score 3.319380952
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000458235.5; ENST00000527670.5; ENST00000527031.5
External Link RMBase: m6A_site_428070
mod ID: M6ASITE040476 Click to Show/Hide the Full List
mod site chr19:17826830-17826831:- [4]
Sequence CGCCCTGGGCCCCCAGCTGGACATGCTGTGGAGCGGAAGCC
Motif Score 3.643047619
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000458235.5; ENST00000527670.5
External Link RMBase: m6A_site_428071
mod ID: M6ASITE040477 Click to Show/Hide the Full List
mod site chr19:17826866-17826867:- [4]
Sequence CTGGGCCCCTAGCCCACAGGACCGGCCATCATTCAGCGCCC
Motif Score 3.622404762
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000527670.5; ENST00000458235.5
External Link RMBase: m6A_site_428072
mod ID: M6ASITE040478 Click to Show/Hide the Full List
mod site chr19:17829857-17829858:- [4]
Sequence AGGGAAGATTAGACTCCTGAACACCTGTGCCTATGAGGGCT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000458235.5; ENST00000534444.1; ENST00000527670.5; rmsk_4957092
External Link RMBase: m6A_site_428073
mod ID: M6ASITE040479 Click to Show/Hide the Full List
mod site chr19:17829865-17829866:- [4]
Sequence ATAGGGTGAGGGAAGATTAGACTCCTGAACACCTGTGCCTA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000534444.1; ENST00000458235.5; ENST00000527031.5; rmsk_4957092; ENST00000527670.5
External Link RMBase: m6A_site_428074
mod ID: M6ASITE040480 Click to Show/Hide the Full List
mod site chr19:17836803-17836804:- [5]
Sequence AGGATGGGCCAGGAGCTGGGACAGAGCCTAGAATGTGACAG
Motif Score 3.643047619
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000458235.5; ENST00000527031.5; ENST00000527670.5; ENST00000534444.1
External Link RMBase: m6A_site_428075
mod ID: M6ASITE040481 Click to Show/Hide the Full List
mod site chr19:17836904-17836905:- [5]
Sequence CCAGAATGACCTGAAGTCAGACAAACCTGGCTTTCTAATCT
Motif Score 2.897386905
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000458235.5; ENST00000527031.5; ENST00000527670.5; rmsk_4957107; ENST00000534444.1
External Link RMBase: m6A_site_428076
mod ID: M6ASITE040482 Click to Show/Hide the Full List
mod site chr19:17840263-17840264:- [4]
Sequence TCTCCGCCGCAGCCCCCAGGACTTTGACAGCTTCCTCCTCA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000534444.1; ENST00000458235.5; ENST00000528705.1; ENST00000526008.5; ENST00000527670.5
External Link RMBase: m6A_site_428077
mod ID: M6ASITE040483 Click to Show/Hide the Full List
mod site chr19:17840312-17840313:- [4]
Sequence TTGCCATCAACAAGCTCAAGACTGGGGGCTCACGTCCTGGC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000528705.1; ENST00000534444.1; ENST00000527670.5; ENST00000527031.5; ENST00000458235.5; ENST00000526008.5
External Link RMBase: m6A_site_428078
mod ID: M6ASITE040484 Click to Show/Hide the Full List
mod site chr19:17840335-17840336:- [4]
Sequence CACCTTCCCCCACAGTCTGGACTTTGCCATCAACAAGCTCA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000526008.5; ENST00000527031.5; ENST00000528705.1; ENST00000458235.5; ENST00000534444.1; ENST00000527670.5
External Link RMBase: m6A_site_428079
mod ID: M6ASITE040486 Click to Show/Hide the Full List
mod site chr19:17842657-17842658:- [6]
Sequence TTGTGTGTGTCCCCGCGGGGACCCCTCCCGACGCTGAGGGC
Motif Score 3.622404762
Cell/Tissue List CD4T
Seq Type List m6A-seq
Transcript ID List ENST00000527670.5; ENST00000526008.5; ENST00000534444.1; ENST00000527031.5; ENST00000458235.5; ENST00000528293.1
External Link RMBase: m6A_site_428080
mod ID: M6ASITE040487 Click to Show/Hide the Full List
mod site chr19:17843086-17843087:- [7]
Sequence TCTCAGCCTGGCCGTGTTGGACCTGGCCCGGATGGCGCGAG
Motif Score 3.622404762
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000527031.5; ENST00000534444.1; ENST00000528293.1; ENST00000527670.5; ENST00000526008.5; ENST00000458235.5
External Link RMBase: m6A_site_428081