m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00300)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
JAK3
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Wilms tumor 1-associating protein (WTAP) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by WTAP | ||
| Cell Line | Human umbilical vein endothelial cells | Homo sapiens |
|
Treatment: siWTAP HUVECs
Control: siControl HUVECs
|
GSE167067 | |
| Regulation |
![]() ![]() |
logFC: 1.47E+00 p-value: 6.40E-04 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | This study established the transcriptional map of m6A in MH7A cells and revealed the potential relationship between RNA methylation modification and rheumatoid arthritis related genes. The results suggested that m6A modification was associated with the occurrence and course of RA to some extent. The validations of WTAP, RIPK2, Tyrosine-protein kinase JAK3 (JAK3) and TNFRSF10A were in accordance with the m6A and RNA sequencing results. | |||
| Responsed Disease | Rheumatoid arthritis | ICD-11: FA20 | ||
| Pathway Response | JAK-STAT signaling pathway | hsa04630 | ||
| Cytokine-cytokine receptor interaction | hsa04060 | |||
| Cell Process | Cell proliferation | |||
| Cell apoptosis | ||||
| In-vitro Model | MH7A | Normal | Homo sapiens | CVCL_0427 |
| In-vivo Model | The rats were adaptively fed for 1 week and then subcutaneous injection of complete Freund's adjuvant into the left hindfoot toe to establish an adjuvant arthritis (AA) rat model. After induction of the immune response for 20 days, all rats were anesthetized by the intraperitoneal injection of 1% sodium pentobarbital (60 mg/kg) and sacrificed by exsanguination of the abdominal aorta. | |||
Rheumatoid arthritis [ICD-11: FA20]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | This study established the transcriptional map of m6A in MH7A cells and revealed the potential relationship between RNA methylation modification and rheumatoid arthritis related genes. The results suggested that m6A modification was associated with the occurrence and course of RA to some extent. The validations of WTAP, RIPK2, Tyrosine-protein kinase JAK3 (JAK3) and TNFRSF10A were in accordance with the m6A and RNA sequencing results. | |||
| Responsed Disease | Rheumatoid arthritis [ICD-11: FA20] | |||
| Target Regulator | Wilms tumor 1-associating protein (WTAP) | WRITER | ||
| Pathway Response | JAK-STAT signaling pathway | hsa04630 | ||
| Cytokine-cytokine receptor interaction | hsa04060 | |||
| Cell Process | Cell proliferation | |||
| Cell apoptosis | ||||
| In-vitro Model | MH7A | Normal | Homo sapiens | CVCL_0427 |
| In-vivo Model | The rats were adaptively fed for 1 week and then subcutaneous injection of complete Freund's adjuvant into the left hindfoot toe to establish an adjuvant arthritis (AA) rat model. After induction of the immune response for 20 days, all rats were anesthetized by the intraperitoneal injection of 1% sodium pentobarbital (60 mg/kg) and sacrificed by exsanguination of the abdominal aorta. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00300)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE009105 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826378-17826379:- | [2] | |
| Sequence | TTTATTTTTATTTTTGAGACAGAGCCTCGCTCTGTTACCCA | ||
| Transcript ID List | ENST00000527031.5; ENST00000527670.5; ENST00000458235.5 | ||
| External Link | RMBase: RNA-editing_site_67647 | ||
5-methylcytidine (m5C)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE001846 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826886-17826887:- | [3] | |
| Sequence | CACGAGCTCATGAAGCTGTGCTGGGCCCCTAGCCCACAGGA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000458235.5; ENST00000527670.5 | ||
| External Link | RMBase: m5C_site_23557 | ||
| mod ID: M5CSITE001847 | Click to Show/Hide the Full List | ||
| mod site | chr19:17831349-17831350:- | [3] | |
| Sequence | GTGCACCGCGACCTGGCCGCCCGAAACATCCTCGTGGAGAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000534444.1; ENST00000527031.5; ENST00000458235.5; ENST00000527670.5 | ||
| External Link | RMBase: m5C_site_23558 | ||
N6-methyladenosine (m6A)
| In total 14 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE040472 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826728-17826729:- | [4] | |
| Sequence | TTCATAGCTCCTGCCCGCAGACCTCTGGATTAGGTCTCTGT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000527670.5; rmsk_4957080; ENST00000458235.5 | ||
| External Link | RMBase: m6A_site_428068 | ||
| mod ID: M6ASITE040473 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826766-17826767:- | [4] | |
| Sequence | ACTGCTCACCCAGAGGGCAAACACCACTCCCTGTCCTTTTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000527670.5; ENST00000458235.5 | ||
| External Link | RMBase: m6A_site_428069 | ||
| mod ID: M6ASITE040475 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826798-17826799:- | [4] | |
| Sequence | GCGGAAGCCGGGGGTGTGAGACTCATGCCTTCACTGCTCAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458235.5; ENST00000527670.5; ENST00000527031.5 | ||
| External Link | RMBase: m6A_site_428070 | ||
| mod ID: M6ASITE040476 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826830-17826831:- | [4] | |
| Sequence | CGCCCTGGGCCCCCAGCTGGACATGCTGTGGAGCGGAAGCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000458235.5; ENST00000527670.5 | ||
| External Link | RMBase: m6A_site_428071 | ||
| mod ID: M6ASITE040477 | Click to Show/Hide the Full List | ||
| mod site | chr19:17826866-17826867:- | [4] | |
| Sequence | CTGGGCCCCTAGCCCACAGGACCGGCCATCATTCAGCGCCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000527670.5; ENST00000458235.5 | ||
| External Link | RMBase: m6A_site_428072 | ||
| mod ID: M6ASITE040478 | Click to Show/Hide the Full List | ||
| mod site | chr19:17829857-17829858:- | [4] | |
| Sequence | AGGGAAGATTAGACTCCTGAACACCTGTGCCTATGAGGGCT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000458235.5; ENST00000534444.1; ENST00000527670.5; rmsk_4957092 | ||
| External Link | RMBase: m6A_site_428073 | ||
| mod ID: M6ASITE040479 | Click to Show/Hide the Full List | ||
| mod site | chr19:17829865-17829866:- | [4] | |
| Sequence | ATAGGGTGAGGGAAGATTAGACTCCTGAACACCTGTGCCTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000534444.1; ENST00000458235.5; ENST00000527031.5; rmsk_4957092; ENST00000527670.5 | ||
| External Link | RMBase: m6A_site_428074 | ||
| mod ID: M6ASITE040480 | Click to Show/Hide the Full List | ||
| mod site | chr19:17836803-17836804:- | [5] | |
| Sequence | AGGATGGGCCAGGAGCTGGGACAGAGCCTAGAATGTGACAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458235.5; ENST00000527031.5; ENST00000527670.5; ENST00000534444.1 | ||
| External Link | RMBase: m6A_site_428075 | ||
| mod ID: M6ASITE040481 | Click to Show/Hide the Full List | ||
| mod site | chr19:17836904-17836905:- | [5] | |
| Sequence | CCAGAATGACCTGAAGTCAGACAAACCTGGCTTTCTAATCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458235.5; ENST00000527031.5; ENST00000527670.5; rmsk_4957107; ENST00000534444.1 | ||
| External Link | RMBase: m6A_site_428076 | ||
| mod ID: M6ASITE040482 | Click to Show/Hide the Full List | ||
| mod site | chr19:17840263-17840264:- | [4] | |
| Sequence | TCTCCGCCGCAGCCCCCAGGACTTTGACAGCTTCCTCCTCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000534444.1; ENST00000458235.5; ENST00000528705.1; ENST00000526008.5; ENST00000527670.5 | ||
| External Link | RMBase: m6A_site_428077 | ||
| mod ID: M6ASITE040483 | Click to Show/Hide the Full List | ||
| mod site | chr19:17840312-17840313:- | [4] | |
| Sequence | TTGCCATCAACAAGCTCAAGACTGGGGGCTCACGTCCTGGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000528705.1; ENST00000534444.1; ENST00000527670.5; ENST00000527031.5; ENST00000458235.5; ENST00000526008.5 | ||
| External Link | RMBase: m6A_site_428078 | ||
| mod ID: M6ASITE040484 | Click to Show/Hide the Full List | ||
| mod site | chr19:17840335-17840336:- | [4] | |
| Sequence | CACCTTCCCCCACAGTCTGGACTTTGCCATCAACAAGCTCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000526008.5; ENST00000527031.5; ENST00000528705.1; ENST00000458235.5; ENST00000534444.1; ENST00000527670.5 | ||
| External Link | RMBase: m6A_site_428079 | ||
| mod ID: M6ASITE040486 | Click to Show/Hide the Full List | ||
| mod site | chr19:17842657-17842658:- | [6] | |
| Sequence | TTGTGTGTGTCCCCGCGGGGACCCCTCCCGACGCTGAGGGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | CD4T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527670.5; ENST00000526008.5; ENST00000534444.1; ENST00000527031.5; ENST00000458235.5; ENST00000528293.1 | ||
| External Link | RMBase: m6A_site_428080 | ||
| mod ID: M6ASITE040487 | Click to Show/Hide the Full List | ||
| mod site | chr19:17843086-17843087:- | [7] | |
| Sequence | TCTCAGCCTGGCCGTGTTGGACCTGGCCCGGATGGCGCGAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000527031.5; ENST00000534444.1; ENST00000528293.1; ENST00000527670.5; ENST00000526008.5; ENST00000458235.5 | ||
| External Link | RMBase: m6A_site_428081 | ||
References

