m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00291)
Target Name Insulin-like growth factor I (IGF1)
Synonyms
IGF-I; Mechano growth factor; MGF; Somatomedin-C; IBP1
    Click to Show/Hide
Gene Name IGF1
Chromosomal Location 12q23.2
Family insulin family
Function
The insulin-like growth factors, isolated from plasma, are structurally and functionally related to insulin but have a much higher growth-promoting activity. May be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. Stimulates glucose transport in bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. May play a role in synapse maturation. Ca(2+)-dependent exocytosis of IGF1 is required for sensory perception of smell in the olfactory bulb (By similarity). Acts as a ligand for IGF1R. Binds to the alpha subunit of IGF1R, leading to the activation of the intrinsic tyrosine kinase activity which autophosphorylates tyrosine residues in the beta subunit thus initiatiating a cascade of down-stream signaling events leading to activation of the PI3K-AKT/PKB and the Ras-MAPK pathways. Binds to integrins ITGAV:ITGB3 and ITGA6:ITGB4. Its binding to integrins and subsequent ternary complex formation with integrins and IGFR1 are essential for IGF1 signaling. Induces the phosphorylation and activation of IGFR1, MAPK3/ERK1, MAPK1/ERK2 and AKT1.
    Click to Show/Hide
Gene ID 3479
Uniprot ID
IGF1_HUMAN
HGNC ID
HGNC:5464
KEGG ID
hsa:3479
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
IGF1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line DKO-1 cell line Homo sapiens
Treatment: METTL3 knockdown DKO-1 cell
Control: DKO-1 cell
 GSE182382
Regulation
logFC: -2.21E+00
p-value: 2.40E-02
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between IGF1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 6.27E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The long-lived endocrine mutants - Snell dwarf, growth hormone receptor deletion and pregnancy-associated plasma protein-A knockout - all show increases in the N6-adenosine-methyltransferases (METTL3/14) that catalyze 6-methylation of adenosine (m6A) in the 5' UTR region of select mRNAs. In addition, these mice have elevated levels of YTHDF1, which recognizes m6A and promotes translation by a cap-independent mechanism. Augmented translation by cap-independent pathways facilitated by m6A modifications contribute to the stress resistance and increased healthy longevity of mice with diminished GH and Insulin-like growth factor I (IGF1) signals.
Target Regulation Up regulation
Responsed Disease Ageing-related disease ICD-11: 9B10-9B60
 Disease Info 
Pathway Response Nucleotide excision repair hsa03420
Cell Process DNA repair and mitochondrial stress
In-vitro Model Mouse fibroblasts (Major cellular components of loose connective tissue)
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line BMDM Mus musculus
Treatment: METTL14 knockout mice BMDM
Control: Wild type mice BMDM
 GSE153512
Regulation
logFC: -7.37E-01
p-value: 4.88E-20
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The long-lived endocrine mutants - Snell dwarf, growth hormone receptor deletion and pregnancy-associated plasma protein-A knockout - all show increases in the N6-adenosine-methyltransferases (METTL3/14) that catalyze 6-methylation of adenosine (m6A) in the 5' UTR region of select mRNAs. In addition, these mice have elevated levels of YTHDF1, which recognizes m6A and promotes translation by a cap-independent mechanism. Augmented translation by cap-independent pathways facilitated by m6A modifications contribute to the stress resistance and increased healthy longevity of mice with diminished GH and Insulin-like growth factor I (IGF1) signals.
Target Regulation Up regulation
Responsed Disease Ageing-related disease ICD-11: 9B10-9B60
 Disease Info 
Pathway Response Nucleotide excision repair hsa03420
Cell Process DNA repair and mitochondrial stress
In-vitro Model Mouse fibroblasts (Major cellular components of loose connective tissue)
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1
Cell Line AGS cell line Homo sapiens
Treatment: shYTHDF1 AGS
Control: shNC AGS
 GSE166972
Regulation
logFC: -1.17E+00
p-value: 4.12E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The long-lived endocrine mutants - Snell dwarf, growth hormone receptor deletion and pregnancy-associated plasma protein-A knockout - all show increases in the N6-adenosine-methyltransferases (METTL3/14) that catalyze 6-methylation of adenosine (m6A) in the 5' UTR region of select mRNAs. In addition, these mice have elevated levels of YTHDF1, which recognizes m6A and promotes translation by a cap-independent mechanism. Augmented translation by cap-independent pathways facilitated by m6A modifications contribute to the stress resistance and increased healthy longevity of mice with diminished GH and Insulin-like growth factor I (IGF1) signals.
Target Regulation Up regulation
Responsed Disease Ageing-related disease ICD-11: 9B10-9B60
 Disease Info 
Pathway Response Nucleotide excision repair hsa03420
Cell Process DNA repair and mitochondrial stress
In-vitro Model Mouse fibroblasts (Major cellular components of loose connective tissue)
Insulin-like growth factor-binding protein 3 (IGFBP3) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary Overexpression of IGFBP3 induced apoptosis and enhanced cisplatin response in vitro and confirmed that the suppression is in part by blocking Insulin-like growth factor I (IGF1) signaling. IGFBP3 is effective in lung cancer cells with high IGF1 signaling activity and imply that relevant biomarkers are essential in selecting lung cancer patients for IGF1-targeted therapy.
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Responsed Drug Cisplatin Approved
 Drug Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Cell apoptosis
In-vitro Model NCI-H460 Lung large cell carcinoma Homo sapiens CVCL_0459
HCC2429 Lung non-small cell carcinoma Homo sapiens CVCL_5132
In-vivo Model Paired littermates of F2 (Igfbp3+/+:KrasG12D/+ and Igfbp3-/-:KrasG12D/+) were sacrificed ranging from ages 4 to 7 months. After preliminary analysis of F2 mice, we sacrificed 5-month-old Igfbp3+/+:KrasG12D/+ and Igfbp3-/-KrasG12D/+ mice that had been backcrossed to S129 background for representative analysis. The lung tissue was immediately removed after the mice were sacrificed and visible pleural nodules were counted directly.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary Overexpression of IGFBP3 induced apoptosis and enhanced cisplatin response in vitro and confirmed that the suppression is in part by blocking Insulin-like growth factor I (IGF1) signaling. IGFBP3 is effective in lung cancer cells with high IGF1 signaling activity and imply that relevant biomarkers are essential in selecting lung cancer patients for IGF1-targeted therapy.
Responsed Disease Lung cancer [ICD-11: 2C25]
Target Regulator Insulin-like growth factor-binding protein 3 (IGFBP3) READER
 Regulator Info 
Responsed Drug Cisplatin Approved
 Drug Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Cell apoptosis
In-vitro Model NCI-H460 Lung large cell carcinoma Homo sapiens CVCL_0459
HCC2429 Lung non-small cell carcinoma Homo sapiens CVCL_5132
In-vivo Model Paired littermates of F2 (Igfbp3+/+:KrasG12D/+ and Igfbp3-/-:KrasG12D/+) were sacrificed ranging from ages 4 to 7 months. After preliminary analysis of F2 mice, we sacrificed 5-month-old Igfbp3+/+:KrasG12D/+ and Igfbp3-/-KrasG12D/+ mice that had been backcrossed to S129 background for representative analysis. The lung tissue was immediately removed after the mice were sacrificed and visible pleural nodules were counted directly.
Ageing-related disease [ICD-11: 9B10-9B60]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The long-lived endocrine mutants - Snell dwarf, growth hormone receptor deletion and pregnancy-associated plasma protein-A knockout - all show increases in the N6-adenosine-methyltransferases (METTL3/14) that catalyze 6-methylation of adenosine (m6A) in the 5' UTR region of select mRNAs. In addition, these mice have elevated levels of YTHDF1, which recognizes m6A and promotes translation by a cap-independent mechanism. Augmented translation by cap-independent pathways facilitated by m6A modifications contribute to the stress resistance and increased healthy longevity of mice with diminished GH and Insulin-like growth factor I (IGF1) signals.
Responsed Disease Ageing-related disease [ICD-11: 9B10-9B60]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Nucleotide excision repair hsa03420
Cell Process DNA repair and mitochondrial stress
In-vitro Model Mouse fibroblasts (Major cellular components of loose connective tissue)
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary The long-lived endocrine mutants - Snell dwarf, growth hormone receptor deletion and pregnancy-associated plasma protein-A knockout - all show increases in the N6-adenosine-methyltransferases (METTL3/14) that catalyze 6-methylation of adenosine (m6A) in the 5' UTR region of select mRNAs. In addition, these mice have elevated levels of YTHDF1, which recognizes m6A and promotes translation by a cap-independent mechanism. Augmented translation by cap-independent pathways facilitated by m6A modifications contribute to the stress resistance and increased healthy longevity of mice with diminished GH and Insulin-like growth factor I (IGF1) signals.
Responsed Disease Ageing-related disease [ICD-11: 9B10-9B60]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Nucleotide excision repair hsa03420
Cell Process DNA repair and mitochondrial stress
In-vitro Model Mouse fibroblasts (Major cellular components of loose connective tissue)
Cisplatin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary Overexpression of IGFBP3 induced apoptosis and enhanced cisplatin response in vitro and confirmed that the suppression is in part by blocking Insulin-like growth factor I (IGF1) signaling. IGFBP3 is effective in lung cancer cells with high IGF1 signaling activity and imply that relevant biomarkers are essential in selecting lung cancer patients for IGF1-targeted therapy.
Target Regulator Insulin-like growth factor-binding protein 3 (IGFBP3) READER
 Regulator Info 
Responsed Disease Lung cancer ICD-11: 2C25
 Disease Info 
Pathway Response MAPK signaling pathway hsa04010
Cell Process Cell apoptosis
In-vitro Model NCI-H460 Lung large cell carcinoma Homo sapiens CVCL_0459
HCC2429 Lung non-small cell carcinoma Homo sapiens CVCL_5132
In-vivo Model Paired littermates of F2 (Igfbp3+/+:KrasG12D/+ and Igfbp3-/-:KrasG12D/+) were sacrificed ranging from ages 4 to 7 months. After preliminary analysis of F2 mice, we sacrificed 5-month-old Igfbp3+/+:KrasG12D/+ and Igfbp3-/-KrasG12D/+ mice that had been backcrossed to S129 background for representative analysis. The lung tissue was immediately removed after the mice were sacrificed and visible pleural nodules were counted directly.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00291)
Insulin-like growth factor I (IGF1)
2'-O-Methylation (2'-O-Me)
In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000074 Click to Show/Hide the Full List
mod site chr12:102398897-102398898:- [3]
Sequence CTTGGGAGAAGGCTTAGAATAAAAGATGTAGCACATTTTGC
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000337514.10
External Link RMBase: Nm_site_1477
N6-methyladenosine (m6A)
In total 26 m6A sequence/site(s) in this target gene
mod ID: M6ASITE014676 Click to Show/Hide the Full List
mod site chr12:102401284-102401285:- [4]
Sequence ATCTGCCAGCTGTGTCATGGACTCACCACTGTGTGACCTTG
Motif Score 4.065041667
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List rmsk_3882535; ENST00000337514.10
External Link RMBase: m6A_site_204810
mod ID: M6ASITE014677 Click to Show/Hide the Full List
mod site chr12:102401306-102401307:- [4]
Sequence TTTTCTCATGGAAGAAATGAACATCTGCCAGCTGTGTCATG
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337514.10; rmsk_3882535
External Link RMBase: m6A_site_204811
mod ID: M6ASITE014678 Click to Show/Hide the Full List
mod site chr12:102401378-102401379:- [4]
Sequence CTGGCGAGTCCAGAGAGGAAACTGTGGAATGGAAAAAGCAG
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337514.10; rmsk_3882535
External Link RMBase: m6A_site_204814
mod ID: M6ASITE014679 Click to Show/Hide the Full List
mod site chr12:102401399-102401400:- [4]
Sequence AGTCCACTGATGCAAATTGGACTGGCGAGTCCAGAGAGGAA
Motif Score 4.065041667
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337514.10
External Link RMBase: m6A_site_204816
mod ID: M6ASITE014680 Click to Show/Hide the Full List
mod site chr12:102401426-102401427:- [4]
Sequence CCTTCCAAGAGGAACTTCAGACACAAAAGTCCACTGATGCA
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337514.10
External Link RMBase: m6A_site_204818
mod ID: M6ASITE014681 Click to Show/Hide the Full List
mod site chr12:102401433-102401434:- [4]
Sequence AGTTATGCCTTCCAAGAGGAACTTCAGACACAAAAGTCCAC
Motif Score 3.373380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337514.10
External Link RMBase: m6A_site_204819
mod ID: M6ASITE014682 Click to Show/Hide the Full List
mod site chr12:102401489-102401490:- [4]
Sequence CAAGGGGAAGGGTACTGAAAACACCATCCATTTGGGAAAGA
Motif Score 2.20572619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000337514.10
External Link RMBase: m6A_site_204821
mod ID: M6ASITE014683 Click to Show/Hide the Full List
mod site chr12:102402355-102402356:- [4]
Sequence CCAATGAAATACACAAGTAAACATTCCAACATTGTCTTTAG
Motif Score 2.20572619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000481539.1; ENST00000337514.10; ENST00000644491.1; ENST00000392904.5
External Link RMBase: m6A_site_204823
mod ID: M6ASITE014684 Click to Show/Hide the Full List
mod site chr12:102402425-102402426:- [4]
Sequence GTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTT
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000644491.1; ENST00000481539.1; ENST00000337514.10; ENST00000392904.5
External Link RMBase: m6A_site_204825
mod ID: M6ASITE014685 Click to Show/Hide the Full List
mod site chr12:102402433-102402434:- [4]
Sequence CTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAA
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000481539.1; ENST00000392904.5; ENST00000644491.1; ENST00000337514.10
External Link RMBase: m6A_site_204826
mod ID: M6ASITE014686 Click to Show/Hide the Full List
mod site chr12:102402501-102402502:- [4]
Sequence GAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAG
Motif Score 2.876744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000392904.5; ENST00000481539.1; ENST00000644491.1; ENST00000424202.6; ENST00000337514.10
External Link RMBase: m6A_site_204827
mod ID: M6ASITE014687 Click to Show/Hide the Full List
mod site chr12:102402519-102402520:- [4]
Sequence AGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACC
Motif Score 3.373380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000644491.1; ENST00000392904.5; ENST00000392905.7; ENST00000424202.6; ENST00000337514.10; ENST00000481539.1
External Link RMBase: m6A_site_204828
mod ID: M6ASITE014688 Click to Show/Hide the Full List
mod site chr12:102402525-102402526:- [4]
Sequence AAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGG
Motif Score 2.20572619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000424202.6; ENST00000337514.10; ENST00000392904.5; ENST00000392905.7; ENST00000644491.1; ENST00000481539.1
External Link RMBase: m6A_site_204829
mod ID: M6ASITE014689 Click to Show/Hide the Full List
mod site chr12:102417596-102417597:- [5]
Sequence CCTAGAAAGCGCAAAGAAAGACAGTGGCAAAAATGAAAAAA
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000337514.10; ENST00000392905.7; ENST00000644491.1; ENST00000392904.5; ENST00000307046.8; ENST00000424202.6
External Link RMBase: m6A_site_204830
mod ID: M6ASITE014690 Click to Show/Hide the Full List
mod site chr12:102417649-102417650:- [5]
Sequence TTAGAGAATCTCGCTAAGAAACATGGAGAAAACGGAAAAGA
Motif Score 2.20572619
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000307046.8; ENST00000392905.7; ENST00000392904.5; ENST00000424202.6; ENST00000644491.1; ENST00000337514.10
External Link RMBase: m6A_site_204831
mod ID: M6ASITE014691 Click to Show/Hide the Full List
mod site chr12:102417766-102417767:- [5]
Sequence GGATGATGAGAGAGGAGCAGACAGCAAGAATGAAAAGCAGA
Motif Score 2.897386905
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000392905.7; ENST00000307046.8; ENST00000424202.6; ENST00000392904.5; ENST00000644491.1; ENST00000337514.10
External Link RMBase: m6A_site_204832
mod ID: M6ASITE014692 Click to Show/Hide the Full List
mod site chr12:102417800-102417801:- [5]
Sequence ATGAAGGACAGGAGGATTAAACAGACAGAGGCAAGGATGAT
Motif Score 2.20572619
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000392904.5; ENST00000337514.10; ENST00000307046.8; ENST00000424202.6; ENST00000392905.7; ENST00000644491.1
External Link RMBase: m6A_site_204833
mod ID: M6ASITE014693 Click to Show/Hide the Full List
mod site chr12:102417813-102417814:- [5]
Sequence GCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAG
Motif Score 3.643047619
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000337514.10; ENST00000307046.8; ENST00000424202.6; ENST00000644491.1; ENST00000392904.5; ENST00000392905.7
External Link RMBase: m6A_site_204834
mod ID: M6ASITE014694 Click to Show/Hide the Full List
mod site chr12:102417912-102417913:- [5]
Sequence GAGGGGAACAGAAGGAGGGGACAGAAGCAAGTCTGCAGATC
Motif Score 3.643047619
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000307046.8; ENST00000392904.5; ENST00000392905.7; ENST00000337514.10; ENST00000424202.6; ENST00000644491.1
External Link RMBase: m6A_site_204835
mod ID: M6ASITE014695 Click to Show/Hide the Full List
mod site chr12:102417925-102417926:- [4]
Sequence AAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000392904.5; ENST00000337514.10; ENST00000307046.8; ENST00000644491.1; ENST00000392905.7; ENST00000424202.6
External Link RMBase: m6A_site_204836
mod ID: M6ASITE014696 Click to Show/Hide the Full List
mod site chr12:102417942-102417943:- [4]
Sequence GAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAG
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000307046.8; ENST00000392905.7; ENST00000392904.5; ENST00000644491.1; ENST00000337514.10; ENST00000424202.6
External Link RMBase: m6A_site_204837
mod ID: M6ASITE014697 Click to Show/Hide the Full List
mod site chr12:102417977-102417978:- [4]
Sequence GCCCCCATCTACCAACAAGAACACGAAGTCTCAGAGAAGGA
Motif Score 2.951386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000307046.8; ENST00000392905.7; ENST00000337514.10; ENST00000392904.5; ENST00000644491.1; ENST00000424202.6
External Link RMBase: m6A_site_204838
mod ID: M6ASITE014698 Click to Show/Hide the Full List
mod site chr12:102419516-102419517:- [4]
Sequence GCCACACCGACATGCCCAAGACCCAGAAGGTAAGCCCACCT
Motif Score 2.876744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000644491.1; ENST00000307046.8; ENST00000337514.10; ENST00000392905.7; ENST00000424202.6; ENST00000392904.5
External Link RMBase: m6A_site_204839
mod ID: M6ASITE014699 Click to Show/Hide the Full List
mod site chr12:102419645-102419646:- [4]
Sequence GCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGC
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000644491.1; ENST00000307046.8; ENST00000392904.5; ENST00000392905.7; ENST00000337514.10; ENST00000424202.6
External Link RMBase: m6A_site_204840
mod ID: M6ASITE014700 Click to Show/Hide the Full List
mod site chr12:102475659-102475660:- [4]
Sequence TCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAGTA
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000424202.6; ENST00000644491.1; ENST00000392905.7; ENST00000307046.8; ENST00000337514.10; ENST00000392904.5
External Link RMBase: m6A_site_204841
mod ID: M6ASITE014701 Click to Show/Hide the Full List
mod site chr12:102475715-102475716:- [4]
Sequence ACCAGCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGC
Motif Score 3.622404762
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000424202.6; ENST00000644491.1; ENST00000392905.7; ENST00000307046.8; ENST00000337514.10; ENST00000392904.5
External Link RMBase: m6A_site_204842