m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00289)
Target Name Interferon-induced 54 kDa protein (IFIT2)
Synonyms
IFIT-2; ISG-54 K; Interferon-induced 54 kDa protein; IFI-54K; P54; CIG-42; G10P2; IFI54; ISG54
    Click to Show/Hide
Gene Name IFIT2
Chromosomal Location 10q23.31
Family IFIT family
Function
IFN-induced antiviral protein which inhibits expression of viral messenger RNAs lacking 2'-O-methylation of the 5' cap. The ribose 2'-O-methylation would provide a molecular signature to distinguish between self and non-self mRNAs by the host during viral infection. Viruses evolved several ways to evade this restriction system such as encoding their own 2'-O-methylase for their mRNAs or by stealing host cap containing the 2'-O-methylation (cap snatching mechanism). Binds AU-rich viral RNAs, with or without 5' triphosphorylation, RNA-binding is required for antiviral activity. Can promote apoptosis.
    Click to Show/Hide
Gene ID 3433
Uniprot ID
IFIT2_HUMAN
HGNC ID
HGNC:5409
KEGG ID
hsa:3433
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
IFIT2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LNCaP cell line Homo sapiens
Treatment: shMETTL3 LNCaP cells
Control: shControl LNCaP cells
 GSE147884
Regulation
logFC: 9.21E-01
p-value: 1.94E-18
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 was upregulated and predicted poor prognosis of patients with intrahepatic cholangiocarcinoma(ICC). H3K4me3 activation-driven METTL3 transcription promotes ICC progression by YTHDF2-mediated Interferon-induced 54 kDa protein (IFIT2) mRNA degradation.
Target Regulation Down regulation
Responsed Disease Intrahepatic cholangiocarcinoma ICD-11: 2C12.10
 Disease Info 
In-vitro Model HuCC-T1 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_0324
HCCC-9810 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_6908
In-vivo Model 4-week-old female BALB/c nude mice were used for HuCC-T1 tumor xenograft models and 4-week-old female B-NDG mice (Biocytogen, Beijing, China) were used for HCCC-9810 tumor xenograft models. 1 × 107 HuCC-T1 or HCCC-9810 cells were resuspended in 100 ul PBS with Matrigel (1:1), and injected into the right flank of mice (n = 6/group).
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 was upregulated and predicted poor prognosis of patients with intrahepatic cholangiocarcinoma(ICC). H3K4me3 activation-driven METTL3 transcription promotes ICC progression by YTHDF2-mediated Interferon-induced 54 kDa protein (IFIT2) mRNA degradation.
Responsed Disease Intrahepatic cholangiocarcinoma [ICD-11: 2C12.10]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
In-vitro Model HuCC-T1 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_0324
HCCC-9810 Intrahepatic cholangiocarcinoma Homo sapiens CVCL_6908
In-vivo Model 4-week-old female BALB/c nude mice were used for HuCC-T1 tumor xenograft models and 4-week-old female B-NDG mice (Biocytogen, Beijing, China) were used for HCCC-9810 tumor xenograft models. 1 × 107 HuCC-T1 or HCCC-9810 cells were resuspended in 100 ul PBS with Matrigel (1:1), and injected into the right flank of mice (n = 6/group).
Melanoma [ICD-11: 2C30]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary In skin cutaneous melanoma, drug sensitivity analysis indicated that the high expression of Interferon-induced 54 kDa protein (IFIT2) was sensitive to dasatinib drug. The expressing levels of IFITs were found to be positively correlated with the level of immune cell infiltrates, immune biomarkers and m6A regulators.
Responsed Disease Melanoma of skin [ICD-11: 2C30.Z]
Responsed Drug Dasatinib Approved
 Drug Info 
Cell Process Cell apoptosis
Epithelial-mesenchymal transition
Cell cycle
Dasatinib [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response []
Response Summary In skin cutaneous melanoma, drug sensitivity analysis indicated that the high expression of Interferon-induced 54 kDa protein (IFIT2) was sensitive to dasatinib drug. The expressing levels of IFITs were found to be positively correlated with the level of immune cell infiltrates, immune biomarkers and m6A regulators.
Responsed Disease Melanoma of skin ICD-11: 2C30.Z
 Disease Info 
Cell Process Cell apoptosis
Epithelial-mesenchymal transition
Cell cycle
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00289)
Interferon-induced 54 kDa protein (IFIT2)
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004733 Click to Show/Hide the Full List
mod site chr10:89308035-89308036:+
Sequence GAAGCGACGGGTACAAAAAGCAATGTGTACAAGAAGACTTT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000638108.1; ENST00000371826.4; ENST00000611722.1
External Link RMBase: m5C_site_5623
N6-methyladenosine (m6A)
In total 57 m6A sequence/site(s) in this target gene
mod ID: M6ASITE001352 Click to Show/Hide the Full List
mod site chr10:89283848-89283849:+ [2]
Sequence GCAAATCAGCCTTTGCCAGAACACTGCAGGACACCAGTGCA
Motif Score 2.951386905
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000437032.1; ENST00000354541.7; ENST00000448897.1; ENST00000638108.1
External Link RMBase: m6A_site_109620
mod ID: M6ASITE001353 Click to Show/Hide the Full List
mod site chr10:89283858-89283859:+ [2]
Sequence CTTTGCCAGAACACTGCAGGACACCAGTGCAGCGCCCAGCC
Motif Score 3.643047619
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000437032.1; ENST00000448897.1; ENST00000638108.1; ENST00000354541.7
External Link RMBase: m6A_site_109621
mod ID: M6ASITE001354 Click to Show/Hide the Full List
mod site chr10:89284064-89284065:+ [2]
Sequence AAAATCTGTGGCGCTTCCAGACTCATATCAACATTCCCTGA
Motif Score 3.319380952
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000448897.1; ENST00000354541.7; ENST00000437032.1; ENST00000638108.1
External Link RMBase: m6A_site_109622
mod ID: M6ASITE001355 Click to Show/Hide the Full List
mod site chr10:89285144-89285145:+ [2]
Sequence GCCGTGACTCGGATCGGGGAACCTCCCTTGGGAGATCAATC
Motif Score 2.930744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List rmsk_3375130; ENST00000354541.7; ENST00000638108.1; ENST00000448897.1
External Link RMBase: m6A_site_109623
mod ID: M6ASITE001356 Click to Show/Hide the Full List
mod site chr10:89285224-89285225:+ [2]
Sequence CTACGACCTCTGCTCCTCAGACCAACCAGCCCAAGGAACAT
Motif Score 2.876744048
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List rmsk_3375130; ENST00000354541.7; ENST00000638108.1; ENST00000448897.1
External Link RMBase: m6A_site_109624
mod ID: M6ASITE001357 Click to Show/Hide the Full List
mod site chr10:89285241-89285242:+ [2]
Sequence CAGACCAACCAGCCCAAGGAACATCTCACCAATTTTAAATC
Motif Score 2.951386905
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000354541.7; rmsk_3375130; ENST00000638108.1; ENST00000448897.1
External Link RMBase: m6A_site_109625
mod ID: M6ASITE001358 Click to Show/Hide the Full List
mod site chr10:89292020-89292021:+ [2]
Sequence TAGAGTCACAGGATGGAAGAACTCTGTGTCCTTGAATCATT
Motif Score 3.373380952
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List rmsk_3375141; ENST00000448897.1; ENST00000354541.7; ENST00000638108.1
External Link RMBase: m6A_site_109626
mod ID: M6ASITE001359 Click to Show/Hide the Full List
mod site chr10:89292053-89292054:+ [2]
Sequence GAATCATTGCATGGAAGAGAACTGGAAGTTGCCCAGGAACA
Motif Score 3.373380952
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000448897.1; rmsk_3375141; ENST00000638108.1; ENST00000354541.7
External Link RMBase: m6A_site_109628
mod ID: M6ASITE001360 Click to Show/Hide the Full List
mod site chr10:89292071-89292072:+ [2]
Sequence GAACTGGAAGTTGCCCAGGAACACCAGCCTTGGACAGTTAT
Motif Score 2.951386905
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List rmsk_3375141; ENST00000448897.1; ENST00000354541.7; ENST00000638108.1
External Link RMBase: m6A_site_109629
mod ID: M6ASITE001361 Click to Show/Hide the Full List
mod site chr10:89292084-89292085:+ [2]
Sequence CCCAGGAACACCAGCCTTGGACAGTTATGTGAACAAGAAAT
Motif Score 3.643047619
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000638108.1; ENST00000354541.7; rmsk_3375141; ENST00000448897.1
External Link RMBase: m6A_site_109630
mod ID: M6ASITE001362 Click to Show/Hide the Full List
mod site chr10:89292096-89292097:+ [2]
Sequence AGCCTTGGACAGTTATGTGAACAAGAAATAAACTTCTTTTA
Motif Score 2.951386905
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List rmsk_3375141; ENST00000638108.1; ENST00000448897.1; ENST00000354541.7
External Link RMBase: m6A_site_109631
mod ID: M6ASITE001363 Click to Show/Hide the Full List
mod site chr10:89292107-89292108:+ [2]
Sequence GTTATGTGAACAAGAAATAAACTTCTTTTACAGTGTCATTT
Motif Score 2.627720238
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List rmsk_3375141; ENST00000354541.7; ENST00000448897.1; ENST00000638108.1
External Link RMBase: m6A_site_109632
mod ID: M6ASITE001364 Click to Show/Hide the Full List
mod site chr10:89302000-89302001:+ [3]
Sequence AGGGAAACAAACAAAAAGGAACCAGAGGCCACTTGTATATA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List MeRIP-seq
Transcript ID List ENST00000638108.1
External Link RMBase: m6A_site_109634
mod ID: M6ASITE001365 Click to Show/Hide the Full List
mod site chr10:89302084-89302085:+ [3]
Sequence TGAAGAGTGCAGCTGCCTGAACCGAGCCCTGCCGAACAGCT
Motif Score 2.930744048
Cell/Tissue List HeLa; A549; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109635
mod ID: M6ASITE001366 Click to Show/Hide the Full List
mod site chr10:89302099-89302100:+ [3]
Sequence CCTGAACCGAGCCCTGCCGAACAGCTGAGAATTGCACTGCA
Motif Score 2.951386905
Cell/Tissue List HeLa; A549; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109636
mod ID: M6ASITE001367 Click to Show/Hide the Full List
mod site chr10:89305966-89305967:+ [3]
Sequence TGTTTTTCCCTACAGTGAGAACAATAAGAATTCCTTGGAGA
Motif Score 2.951386905
Cell/Tissue List HeLa; A549; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109637
mod ID: M6ASITE001368 Click to Show/Hide the Full List
mod site chr10:89306023-89306024:+ [3]
Sequence AAAATGCCATTTCACCTGGAACTTGATGGAGGGAGAAAACT
Motif Score 3.373380952
Cell/Tissue List HeLa; A549; MM6; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109638
mod ID: M6ASITE001369 Click to Show/Hide the Full List
mod site chr10:89306041-89306042:+ [3]
Sequence GAACTTGATGGAGGGAGAAAACTCCTTGGATGATTTTGAAG
Motif Score 2.627720238
Cell/Tissue List HeLa; A549; MM6; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109639
mod ID: M6ASITE001370 Click to Show/Hide the Full List
mod site chr10:89306062-89306063:+ [3]
Sequence CTCCTTGGATGATTTTGAAGACAAAGTATTTTACCGGACTG
Motif Score 2.897386905
Cell/Tissue List HeLa; A549; hESC-HEK293T; MM6; Huh7; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109640
mod ID: M6ASITE001371 Click to Show/Hide the Full List
mod site chr10:89306079-89306080:+ [3]
Sequence AAGACAAAGTATTTTACCGGACTGAGTTTCAGAATCGTGAA
Motif Score 4.065041667
Cell/Tissue List HeLa; A549; MM6; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109641
mod ID: M6ASITE001372 Click to Show/Hide the Full List
mod site chr10:89306109-89306110:+ [4]
Sequence AGAATCGTGAATTCAAAGCCACAATGTGCAACCTACTGGCC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000638108.1; ENST00000371826.4; ENST00000611722.1
External Link RMBase: m6A_site_109642
mod ID: M6ASITE001373 Click to Show/Hide the Full List
mod site chr10:89306251-89306252:+ [3]
Sequence AAGTCTGGTCACCTGGGGAAACTATGCCTGGGTCTACTATC
Motif Score 2.627720238
Cell/Tissue List HeLa; A549; HepG2; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109643
mod ID: M6ASITE001374 Click to Show/Hide the Full List
mod site chr10:89306308-89306309:+ [3]
Sequence AGACGTTCAGATTTATGTAGACAAGGTGAAACATGTCTGTG
Motif Score 2.897386905
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; iSLK; HEC-1-A; NB4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000371826.4; ENST00000611722.1
External Link RMBase: m6A_site_109644
mod ID: M6ASITE001375 Click to Show/Hide the Full List
mod site chr10:89306318-89306319:+ [3]
Sequence ATTTATGTAGACAAGGTGAAACATGTCTGTGAGAAGTTTTC
Motif Score 2.20572619
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; iSLK; HEC-1-A; NB4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109645
mod ID: M6ASITE001376 Click to Show/Hide the Full List
mod site chr10:89306388-89306389:+ [5]
Sequence TTGACTGTGAGGAAGGGTGGACACGGTTAAAGTGTGGAGGA
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; GSC-11; iSLK; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4
External Link RMBase: m6A_site_109646
mod ID: M6ASITE001377 Click to Show/Hide the Full List
mod site chr10:89306410-89306411:+ [5]
Sequence ACGGTTAAAGTGTGGAGGAAACCAAAATGAAAGAGCGAAGG
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109647
mod ID: M6ASITE001378 Click to Show/Hide the Full List
mod site chr10:89306467-89306468:+ [5]
Sequence TCTGGAAAAGAAGCCAAAGAACCCAGAATTCACCTCTGGAC
Motif Score 2.930744048
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109648
mod ID: M6ASITE001379 Click to Show/Hide the Full List
mod site chr10:89306486-89306487:+ [5]
Sequence AACCCAGAATTCACCTCTGGACTGGCAATAGCAAGCTACCG
Motif Score 4.065041667
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109649
mod ID: M6ASITE001380 Click to Show/Hide the Full List
mod site chr10:89306512-89306513:+ [5]
Sequence AATAGCAAGCTACCGTCTGGACAACTGGCCACCATCTCAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109650
mod ID: M6ASITE001381 Click to Show/Hide the Full List
mod site chr10:89306746-89306747:+ [6]
Sequence TCGAAGAAAAGATGAGCCAGACAAAGCGATTGAACTGCTTA
Motif Score 2.897386905
Cell/Tissue List HepG2; GM12878; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109651
mod ID: M6ASITE001382 Click to Show/Hide the Full List
mod site chr10:89306759-89306760:+ [6]
Sequence GAGCCAGACAAAGCGATTGAACTGCTTAAAAAGGCTTTAGA
Motif Score 3.373380952
Cell/Tissue List HepG2; GM12878; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109652
mod ID: M6ASITE001383 Click to Show/Hide the Full List
mod site chr10:89306791-89306792:+ [5]
Sequence GGCTTTAGAATACATACCAAACAATGCCTACCTGCATTGCC
Motif Score 2.20572619
Cell/Tissue List HeLa; A549; BGC823; HepG2; GM12878; LCLs; Huh7; iSLK; MSC; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109653
mod ID: M6ASITE001384 Click to Show/Hide the Full List
mod site chr10:89306897-89306898:+ [3]
Sequence GGGAAAAGAAAGTTACTGGAACTAATAGGACACGCTGTGGC
Motif Score 3.373380952
Cell/Tissue List HeLa; A549; BGC823; HepG2; GM12878; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000371826.4; ENST00000611722.1
External Link RMBase: m6A_site_109654
mod ID: M6ASITE001385 Click to Show/Hide the Full List
mod site chr10:89306906-89306907:+ [3]
Sequence AAGTTACTGGAACTAATAGGACACGCTGTGGCTCATCTGAA
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; BGC823; HepG2; GM12878; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4
External Link RMBase: m6A_site_109655
mod ID: M6ASITE001386 Click to Show/Hide the Full List
mod site chr10:89307065-89307066:+ [7]
Sequence GAGCTTACTCCTGTAGCGAAACAACTGCTCCATCTGCGGTA
Motif Score 2.20572619
Cell/Tissue List GM12878; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109656
mod ID: M6ASITE001387 Click to Show/Hide the Full List
mod site chr10:89307121-89307122:+ [5]
Sequence GTACCAAATGAAGTGTGAAGACAAGGCCATCCACCACTTTA
Motif Score 2.897386905
Cell/Tissue List HeLa; A549; GM12878; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000638108.1; ENST00000371826.4
External Link RMBase: m6A_site_109657
mod ID: M6ASITE001388 Click to Show/Hide the Full List
mod site chr10:89307160-89307161:+ [5]
Sequence TATAGAGGGTGTAAAAATAAACCAGAAATCAAGGGAGAAAG
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; GM12878; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109658
mod ID: M6ASITE001389 Click to Show/Hide the Full List
mod site chr10:89307193-89307194:+ [5]
Sequence GGAGAAAGAAAAGATGAAAGACAAACTGCAAAAAATTGCCA
Motif Score 2.897386905
Cell/Tissue List HeLa; A549; hESC-HEK293T; fibroblasts; GM12878; LCLs; Huh7; iSLK; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4
External Link RMBase: m6A_site_109659
mod ID: M6ASITE001390 Click to Show/Hide the Full List
mod site chr10:89307310-89307311:+ [3]
Sequence AATGCAACAAGCAGATGAAGACTCTGAGAGGGGTTTGGAGT
Motif Score 3.319380952
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; TIME; HEC-1-A; GSCs; NB4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4
External Link RMBase: m6A_site_109660
mod ID: M6ASITE001391 Click to Show/Hide the Full List
mod site chr10:89307459-89307460:+ [8]
Sequence GGTATTCAAAATATGTAATGACTGGTATGGCAAAAGATTGG
Motif Score 3.28175
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000611722.1; ENST00000638108.1; rmsk_3375166; ENST00000371826.4
External Link RMBase: m6A_site_109661
mod ID: M6ASITE001392 Click to Show/Hide the Full List
mod site chr10:89307480-89307481:+ [5]
Sequence CTGGTATGGCAAAAGATTGGACTAAGACACTGGCCATACCA
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; BGC823; HepG2; U2OS; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4; rmsk_3375166
External Link RMBase: m6A_site_109662
mod ID: M6ASITE001393 Click to Show/Hide the Full List
mod site chr10:89307486-89307487:+ [5]
Sequence TGGCAAAAGATTGGACTAAGACACTGGCCATACCACTGGAC
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; BGC823; HepG2; U2OS; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1; rmsk_3375166
External Link RMBase: m6A_site_109663
mod ID: M6ASITE001394 Click to Show/Hide the Full List
mod site chr10:89307505-89307506:+ [5]
Sequence GACACTGGCCATACCACTGGACAGGGTTATGTTAACACCTG
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; BGC823; HepG2; U2OS; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; rmsk_3375166; ENST00000371826.4; ENST00000638108.1
External Link RMBase: m6A_site_109664
mod ID: M6ASITE001395 Click to Show/Hide the Full List
mod site chr10:89307569-89307570:+ [5]
Sequence CAAGGAGTTCTGGGAGAGGGACCAGATTGGGGGGTAGGTCC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; iSLK; MSC; TIME; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000611722.1; ENST00000638108.1; ENST00000371826.4
External Link RMBase: m6A_site_109665
mod ID: M6ASITE001396 Click to Show/Hide the Full List
mod site chr10:89307642-89307643:+ [5]
Sequence ACTTCTTGAGTGCAATTTGAACTGTAACATTTGCTTAGTCA
Motif Score 3.373380952
Cell/Tissue List HeLa; A549; HepG2; GM12878; LCLs; MM6; Huh7; GSC-11; iSLK; MSC; TIME; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109666
mod ID: M6ASITE001397 Click to Show/Hide the Full List
mod site chr10:89307840-89307841:+ [7]
Sequence GTTCATCCAAAAGCTGGCGGACCAAAGTCTAAATAGGGCTC
Motif Score 3.622404762
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4
External Link RMBase: m6A_site_109667
mod ID: M6ASITE001398 Click to Show/Hide the Full List
mod site chr10:89307996-89307997:+ [2]
Sequence GTTTGAGACGAGGGCAGAGAACAGGAAGATACATAGCTAGA
Motif Score 2.951386905
Cell/Tissue List HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109668
mod ID: M6ASITE001399 Click to Show/Hide the Full List
mod site chr10:89308051-89308052:+ [9]
Sequence AAAGCAATGTGTACAAGAAGACTTTCAGCAAGTATACAGAG
Motif Score 3.319380952
Cell/Tissue List Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109669
mod ID: M6ASITE001400 Click to Show/Hide the Full List
mod site chr10:89308153-89308154:+ [9]
Sequence TTCTGTACAATACACTAGAAACCAACATAATGTATTTCTTT
Motif Score 2.185083333
Cell/Tissue List Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109670
mod ID: M6ASITE001401 Click to Show/Hide the Full List
mod site chr10:89308177-89308178:+ [5]
Sequence ACATAATGTATTTCTTTAAAACCTGTGTGAAAAAATAAATG
Motif Score 2.185083333
Cell/Tissue List HeLa; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109671
mod ID: M6ASITE001402 Click to Show/Hide the Full List
mod site chr10:89308341-89308342:+ [3]
Sequence TTTTTTTTTGTAAAATGAAGACTGAACTCTGTTCAAATGCT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000371826.4; ENST00000611722.1
External Link RMBase: m6A_site_109672
mod ID: M6ASITE001403 Click to Show/Hide the Full List
mod site chr10:89308346-89308347:+ [3]
Sequence TTTTGTAAAATGAAGACTGAACTCTGTTCAAATGCTTTCAT
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; GM12878; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000611722.1; ENST00000638108.1; ENST00000371826.4
External Link RMBase: m6A_site_109673
mod ID: M6ASITE001404 Click to Show/Hide the Full List
mod site chr10:89308369-89308370:+ [3]
Sequence CTGTTCAAATGCTTTCATGAACCTGGTTTGAGACGGTAGGA
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; GM12878; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109674
mod ID: M6ASITE001405 Click to Show/Hide the Full List
mod site chr10:89308408-89308409:+ [3]
Sequence GAAAGCAACAAAACGTGGGAACCTGGTGACTAAGGGCCTGG
Motif Score 2.930744048
Cell/Tissue List HeLa; A549; HepG2; GM12878; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000371826.4; ENST00000611722.1; ENST00000638108.1
External Link RMBase: m6A_site_109675
mod ID: M6ASITE001406 Click to Show/Hide the Full List
mod site chr10:89308436-89308437:+ [3]
Sequence ACTAAGGGCCTGGTGCAAGGACTTGGGAAATGTCATTGATA
Motif Score 4.065041667
Cell/Tissue List HeLa; A549; HepG2; GM12878; Huh7; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000371826.4; ENST00000611722.1
External Link RMBase: m6A_site_109676
mod ID: M6ASITE001407 Click to Show/Hide the Full List
mod site chr10:89308510-89308511:+ [3]
Sequence TTGGATATTAAGTGATATAAACACTTCTTTTAACTCCGAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; A549; HepG2; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000638108.1; ENST00000611722.1; ENST00000371826.4
External Link RMBase: m6A_site_109677
mod ID: M6ASITE001408 Click to Show/Hide the Full List
mod site chr10:89308607-89308608:+ [9]
Sequence GTAGATGCTGAATAGCCTAGACATCAAAGTTGGTGTGAACC
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000371826.4; ENST00000638108.1; ENST00000611722.1
External Link RMBase: m6A_site_109678