m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00282)

Target Name	Homeobox protein Hox-B4 (HOXB4)
Synonyms	Homeobox protein Hox-2.6; Homeobox protein Hox-2F; HOX2F Click to Show/Hide
Gene Name	HOXB4
Chromosomal Location	17q21.32
Family	Antp homeobox family; Deformed subfamily
Function	Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis. Click to Show/Hide
Gene ID	3214
Uniprot ID	HXB4_HUMAN
HGNC ID	HGNC:5115
KEGG ID	hsa:3214

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

HOXB4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	PANC-1 cell line	Homo sapiens
Treatment: siIGF2BP1 PANC-1 cells Control: siControl PANC-1 cells		GSE161087
Regulation		logFC: -9.62E-01 p-value: 3.85E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	IGF2BP1 decreases leukemia cells' tumorigenicity, promotes myeloid differentiation, increases leukemia cell death, and sensitizes acute myeloid leukemia cells to chemotherapeutic drugs. IGF2BP1 affects proliferation and tumorigenic potential of leukemia cells through critical regulators of self-renewal Homeobox protein Hox-B4 (HOXB4) and MYB and through regulation of expression of the aldehyde dehydrogenase, ALDH1A1.
Target Regulation	Up regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
In-vitro Model	MOLT-16	T acute lymphoblastic leukemia	Homo sapiens	CVCL_1424
	Reh	B acute lymphoblastic leukemia	Homo sapiens	CVCL_1650
	SKNO-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_2196
	Tanoue	B acute lymphoblastic leukemia	Homo sapiens	CVCL_1852
In-vivo Model	For the engraftment experiments, 1×10³ 1×10⁶ cells were injected into tail veins of non-irradiated 6-10 week-old female mice in 100 uL of DPBS per mouse. No blinding or randomization was applied to mice experiments. Routinely, each in vivo experiment was performed with three technical replicates (three mice per group) and independently repeated two to three times for each cell line.

Acute myeloid leukaemia [ICD-11: 2A60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	IGF2BP1 decreases leukemia cells' tumorigenicity, promotes myeloid differentiation, increases leukemia cell death, and sensitizes acute myeloid leukemia cells to chemotherapeutic drugs. IGF2BP1 affects proliferation and tumorigenic potential of leukemia cells through critical regulators of self-renewal Homeobox protein Hox-B4 (HOXB4) and MYB and through regulation of expression of the aldehyde dehydrogenase, ALDH1A1.
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	MOLT-16	T acute lymphoblastic leukemia	Homo sapiens	CVCL_1424
	Reh	B acute lymphoblastic leukemia	Homo sapiens	CVCL_1650
	SKNO-1	Myeloid leukemia with maturation	Homo sapiens	CVCL_2196
	Tanoue	B acute lymphoblastic leukemia	Homo sapiens	CVCL_1852
In-vivo Model	For the engraftment experiments, 1×10³ 1×10⁶ cells were injected into tail veins of non-irradiated 6-10 week-old female mice in 100 uL of DPBS per mouse. No blinding or randomization was applied to mice experiments. Routinely, each in vivo experiment was performed with three technical replicates (three mice per group) and independently repeated two to three times for each cell line.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00282)

Homeobox protein Hox-B4 (HOXB4)

N6-methyladenosine (m6A)

In total 20 m6A sequence/site(s) in this target gene
mod ID: M6ASITE033603		Click to Show/Hide the Full List
mod site	chr17:48575789-48575790:-		[2]
Sequence	AGACTGAAAATGAATGTGAAACTAGGAAATAAAATGTGCCC
Motif Score	2.627720238
Cell/Tissue List	GSC-11; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000489475.5; ENST00000472863.5; ENST00000332503.6; ENST00000460160.5; ENST00000498678.5; ENST00000476342.1; ENST00000465120.3; ENST00000552000.2
External Link	RMBase: m6A_site_369371
mod ID: M6ASITE033604		Click to Show/Hide the Full List
mod site	chr17:48575807-48575808:-		[2]
Sequence	AGCAGAAGCCTCTCTCCTAGACTGAAAATGAATGTGAAACT
Motif Score	3.319380952
Cell/Tissue List	GSC-11; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000498678.5; ENST00000460160.5; ENST00000472863.5; ENST00000476342.1; ENST00000489475.5; ENST00000465120.3; ENST00000332503.6; ENST00000552000.2
External Link	RMBase: m6A_site_369372
mod ID: M6ASITE033605		Click to Show/Hide the Full List
mod site	chr17:48575935-48575936:-		[3]
Sequence	GGAAAAAGAGAGACTCAGAGACCCGGGAGGGCCTTCCTCTG
Motif Score	2.876744048
Cell/Tissue List	HEK293T; A549; GM12878; LCLs; H1299; Jurkat; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000465120.3; ENST00000460160.5; ENST00000472863.5; ENST00000476342.1; ENST00000552000.2; ENST00000498678.5; ENST00000332503.6; ENST00000489475.5
External Link	RMBase: m6A_site_369373
mod ID: M6ASITE033606		Click to Show/Hide the Full List
mod site	chr17:48575943-48575944:-		[3]
Sequence	GAGTCCAAGGAAAAAGAGAGACTCAGAGACCCGGGAGGGCC
Motif Score	3.319380952
Cell/Tissue List	HEK293T; A549; GM12878; LCLs; H1299; Jurkat; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000332503.6; ENST00000476342.1; ENST00000460160.5; ENST00000489475.5; ENST00000465120.3; ENST00000552000.2; ENST00000498678.5; ENST00000472863.5
External Link	RMBase: m6A_site_369374
mod ID: M6ASITE033607		Click to Show/Hide the Full List
mod site	chr17:48576082-48576083:-		[4]
Sequence	CTCATCTTTCGTGCCCATTCACTGAGGGCCAGAATGACTGC
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000489475.5; ENST00000465120.3; ENST00000472863.5; ENST00000498678.5; ENST00000476342.1; ENST00000332503.6; ENST00000552000.2; ENST00000460160.5
External Link	RMBase: m6A_site_369375
mod ID: M6ASITE033608		Click to Show/Hide the Full List
mod site	chr17:48576211-48576212:-		[5]
Sequence	GCTACTGCCGCTGCTGGAAGACAGCCTGGATTTCCTTTCTT
Motif Score	2.897386905
Cell/Tissue List	HEK293T; GM12878; LCLs; MT4; HEK293A-TOA; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000476342.1; ENST00000332503.6; ENST00000465120.3; ENST00000552000.2; ENST00000489475.5; ENST00000460160.5; ENST00000498678.5; ENST00000472863.5
External Link	RMBase: m6A_site_369376
mod ID: M6ASITE033609		Click to Show/Hide the Full List
mod site	chr17:48576265-48576266:-		[6]
Sequence	CATTACCTCGACACCCGCTAACAAATGAGGCCCGGCTCGGC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000332503.6; ENST00000465120.3; ENST00000552000.2; ENST00000460160.5; ENST00000476342.1; ENST00000489475.5; ENST00000472863.5; ENST00000498678.5
External Link	RMBase: m6A_site_369377
mod ID: M6ASITE033610		Click to Show/Hide the Full List
mod site	chr17:48576275-48576276:-		[6]
Sequence	CGGTGGCGACCATTACCTCGACACCCGCTAACAAATGAGGC
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498678.5; ENST00000465120.3; ENST00000552000.2; ENST00000460160.5; ENST00000472863.5; ENST00000332503.6; ENST00000476342.1; ENST00000489475.5
External Link	RMBase: m6A_site_369378
mod ID: M6ASITE033611		Click to Show/Hide the Full List
mod site	chr17:48576429-48576430:-		[7]
Sequence	AAGAAGGAAGAAAGAAAAAGACAGAAAGAGAAATAGGAGGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; LCLs; H1299; Jurkat; GSC-11; HEK293A-TOA; endometrial; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498678.5; ENST00000552000.2; ENST00000460160.5; ENST00000465120.3; ENST00000472863.5; ENST00000332503.6; ENST00000489475.5; ENST00000476342.1
External Link	RMBase: m6A_site_369379
mod ID: M6ASITE033612		Click to Show/Hide the Full List
mod site	chr17:48576537-48576538:-		[6]
Sequence	AAGCTTTATTTATAGAAATGACAATAGAGGGCCACGGGGAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460160.5; ENST00000498678.5; ENST00000332503.6; ENST00000472863.5; ENST00000476342.1; ENST00000465120.3; ENST00000489475.5; ENST00000552000.2
External Link	RMBase: m6A_site_369380
mod ID: M6ASITE033613		Click to Show/Hide the Full List
mod site	chr17:48576649-48576650:-		[8]
Sequence	GCAGGGGATGGGGTGGGGGGACAGGAGGGGGCCCTGGGGCC
Motif Score	3.643047619
Cell/Tissue List	CD34; HEK293T; LCLs; H1299; Jurkat; GSC-11; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000489475.5; ENST00000465120.3; ENST00000552000.2; ENST00000498678.5; ENST00000476342.1; ENST00000472863.5; ENST00000332503.6; ENST00000460160.5
External Link	RMBase: m6A_site_369381
mod ID: M6ASITE033614		Click to Show/Hide the Full List
mod site	chr17:48576696-48576697:-		[5]
Sequence	CCCGCACGCGGGAGCCACGAACCTCGGGGTGGGGGTGGGCA
Motif Score	2.930744048
Cell/Tissue List	HEK293T; LCLs; H1299; Jurkat; GSC-11; HEK293A-TOA; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000476342.1; ENST00000332503.6; ENST00000498678.5; ENST00000460160.5; ENST00000552000.2; ENST00000465120.3; ENST00000472863.5; ENST00000489475.5
External Link	RMBase: m6A_site_369382
mod ID: M6ASITE033615		Click to Show/Hide the Full List
mod site	chr17:48576815-48576816:-		[6]
Sequence	CATGAAGTGGAAAAAAGACCACAAGTTGCCCAACACCAAGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498678.5; ENST00000465120.3; ENST00000460160.5; ENST00000489475.5; ENST00000552000.2; ENST00000476342.1; ENST00000472863.5; ENST00000332503.6
External Link	RMBase: m6A_site_369383
mod ID: M6ASITE033616		Click to Show/Hide the Full List
mod site	chr17:48576818-48576819:-		[9]
Sequence	GCGCATGAAGTGGAAAAAAGACCACAAGTTGCCCAACACCA
Motif Score	2.876744048
Cell/Tissue List	H1299; Jurkat; GSC-11; HEK293T; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000552000.2; ENST00000498678.5; ENST00000332503.6; ENST00000465120.3; ENST00000472863.5; ENST00000460160.5; ENST00000476342.1; ENST00000489475.5
External Link	RMBase: m6A_site_369384
mod ID: M6ASITE033617		Click to Show/Hide the Full List
mod site	chr17:48576842-48576843:-		[9]
Sequence	GATCAAGATCTGGTTCCAGAACCGGCGCATGAAGTGGAAAA
Motif Score	2.930744048
Cell/Tissue List	H1299; Jurkat; GSC-11; HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000460160.5; ENST00000552000.2; ENST00000476342.1; ENST00000332503.6; ENST00000465120.3; ENST00000472863.5; ENST00000489475.5; ENST00000498678.5
External Link	RMBase: m6A_site_369385
mod ID: M6ASITE033618		Click to Show/Hide the Full List
mod site	chr17:48576915-48576916:-		[6]
Sequence	TTCACTACAACCGCTACCTGACACGGCGCCGGAGGGTGGAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000332503.6; ENST00000460160.5; ENST00000465120.3; ENST00000552000.2; ENST00000489475.5; ENST00000472863.5; ENST00000476342.1; ENST00000498678.5
External Link	RMBase: m6A_site_369386
mod ID: M6ASITE033619		Click to Show/Hide the Full List
mod site	chr17:48576978-48576979:-		[10]
Sequence	GGGAGCCCAAGCGCTCTCGGACCGCCTACACGCGCCAGCAG
Motif Score	3.622404762
Cell/Tissue List	LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000498678.5; ENST00000332503.6; ENST00000472863.5; ENST00000460160.5; ENST00000465120.3; ENST00000476342.1; ENST00000552000.2; ENST00000489475.5
External Link	RMBase: m6A_site_369387
mod ID: M6ASITE033620		Click to Show/Hide the Full List
mod site	chr17:48577016-48577017:-		[10]
Sequence	TCTCCGTGTGTGTCCAGTAAACCCCAATTACGCCGGCGGGG
Motif Score	2.185083333
Cell/Tissue List	LCLs; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000476342.1; ENST00000332503.6; ENST00000460160.5; ENST00000552000.2; ENST00000498678.5; ENST00000472863.5; ENST00000489475.5; ENST00000465120.3
External Link	RMBase: m6A_site_369388
mod ID: M6ASITE033621		Click to Show/Hide the Full List
mod site	chr17:48577945-48577946:-		[10]
Sequence	GCCGCCTCCCTGCGCCCAGAACCCCCTGCACCCCAGCCCGT
Motif Score	2.930744048
Cell/Tissue List	LCLs; MT4; GSC-11; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498678.5; ENST00000489475.5; ENST00000472863.5; ENST00000465120.3; ENST00000552000.2; ENST00000332503.6; ENST00000476342.1; ENST00000460160.5
External Link	RMBase: m6A_site_369389
mod ID: M6ASITE033622		Click to Show/Hide the Full List
mod site	chr17:48578287-48578288:-		[11]
Sequence	TTCTTTTTTGATCAACTCAAACTATGTCGACCCCAAGTTCC
Motif Score	2.627720238
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000476342.1; ENST00000465120.3; ENST00000472863.5; ENST00000332503.6; ENST00000460160.5; ENST00000489475.5; ENST00000498678.5; ENST00000552000.2
External Link	RMBase: m6A_site_369390

Ref 1	RNA-binding protein IGF2BP1 maintains leukemia stem cell properties by regulating HOXB4, MYB, and ALDH1A1. Leukemia. 2020 May;34(5):1354-1363. doi: 10.1038/s41375-019-0656-9. Epub 2019 Nov 25.
Ref 2	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 3	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 4	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 5	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 9	The m(6)A Methyltransferase METTL3 Promotes Translation in Human Cancer Cells. Mol Cell. 2016 May 5;62(3):335-345. doi: 10.1016/j.molcel.2016.03.021. Epub 2016 Apr 21.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 11	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map