m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00266)

Target Name	Glia-derived nexin (SERPINE2)
Synonyms	GDN; Peptidase inhibitor 7; PI-7; Protease nexin 1; PN-1; Protease nexin I; Serpin E2; PI7; PN1 Click to Show/Hide
Gene Name	SERPINE2
Chromosomal Location	2q36.1
Family	serpin family
Function	Serine protease inhibitor with activity toward thrombin, trypsin, and urokinase. Promotes neurite extension by inhibiting thrombin. Binds heparin. Click to Show/Hide
Gene ID	5270
Uniprot ID	GDN_HUMAN
HGNC ID	HGNC:8951
KEGG ID	hsa:5270

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SERPINE2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	Human umbilical cord blood CD34+ cells	Homo sapiens
Treatment: YTHDF2 knockdown UCB CD34+ cells Control: Wild type UCB CD34+ cells		GSE107956
Regulation		logFC: 1.40E+00 p-value: 3.23E-07
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	YTHDF2 processed the decay of m6A-containing interleukin 11 (IL11) and Glia-derived nexin (SERPINE2) mRNAs. YTHDF2 transcription succumbed to hypoxia-inducible factor-2-alpha (HIF-2-alpha). Administration of a HIF-2-alpha antagonist (PT2385) restored YTHDF2-programed epigenetic machinery and repressed liver cancer.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Biological regulation
In-vitro Model	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
In-vitro Model	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	A number of 5 × 10⁶ SMMC7721 or MHCC97H cells re-suspended in 100 uL of PBS were subcutaneously injected into the right flank of 6-week old male NCG mice.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	YTHDF2 processed the decay of m6A-containing interleukin 11 (IL11) and Glia-derived nexin (SERPINE2) mRNAs. YTHDF2 transcription succumbed to hypoxia-inducible factor-2-alpha (HIF-2-alpha). Administration of a HIF-2-alpha antagonist (PT2385) restored YTHDF2-programed epigenetic machinery and repressed liver cancer.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	HIF-1 signaling pathway			hsa04066
Cell Process	Biological regulation
In-vitro Model	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
In-vitro Model	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	A number of 5 × 10⁶ SMMC7721 or MHCC97H cells re-suspended in 100 uL of PBS were subcutaneously injected into the right flank of 6-week old male NCG mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03412		Crosstalk Info
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info
Drug	PT2385*	Drug Info
Crosstalk ID: M6ACROT03423		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info
Drug	PT2385*	Drug Info

Non-coding RNA

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05040		Crosstalk Info
Epigenetic Regulator	MicroRNA 145 (MIR145)
Regulated Target	YTH domain-containing family protein 2 (YTHDF2)
Crosstalk relationship	ncRNA → m6A
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00266)

Glia-derived nexin (SERPINE2)

Adenosine-to-Inosine editing (A-to-I)

In total 6 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010250		Click to Show/Hide the Full List
mod site	chr2:223988245-223988246:-		[2]
Sequence	AGCCCAGGATGTTGAGATGCAGTGAGCCCTGATCACATCAC
Transcript ID List	ENST00000409840.7; ENST00000258405.9; ENST00000409304.5; rmsk_832347; ENST00000447280.6; ENST00000432738.5
External Link	RMBase: RNA-editing_site_83870
mod ID: A2ISITE010251		Click to Show/Hide the Full List
mod site	chr2:223988332-223988333:-		[2]
Sequence	CAAAAAAATGTTTAAAAATTAGCCAGGCATGGTGGTGCTCA
Transcript ID List	ENST00000447280.6; ENST00000409840.7; ENST00000258405.9; ENST00000432738.5; ENST00000409304.5; rmsk_832347
External Link	RMBase: RNA-editing_site_83871
mod ID: A2ISITE010252		Click to Show/Hide the Full List
mod site	chr2:223988370-223988371:-		[2]
Sequence	AAGATGATCCTCGGCAACATAGCGAGACCCTGTCTCTACAA
Transcript ID List	ENST00000409304.5; ENST00000409840.7; ENST00000447280.6; rmsk_832347; ENST00000432738.5; ENST00000258405.9
External Link	RMBase: RNA-editing_site_83872
mod ID: A2ISITE010253		Click to Show/Hide the Full List
mod site	chr2:223988374-223988375:-		[2]
Sequence	GTTCAAGATGATCCTCGGCAACATAGCGAGACCCTGTCTCT
Transcript ID List	ENST00000432738.5; ENST00000447280.6; ENST00000409840.7; rmsk_832347; ENST00000409304.5; ENST00000258405.9
External Link	RMBase: RNA-editing_site_83873
mod ID: A2ISITE010254		Click to Show/Hide the Full List
mod site	chr2:223990946-223990947:-		[2]
Sequence	CTCACTGTGTTACCCAGGCTAGACTACAGTGGCACAAACAT
Transcript ID List	ENST00000409304.5; ENST00000409840.7; ENST00000432738.5; ENST00000258405.9; ENST00000447280.6
External Link	RMBase: RNA-editing_site_83874
mod ID: A2ISITE010255		Click to Show/Hide the Full List
mod site	chr2:223990969-223990970:-		[2]
Sequence	AAAAAACTTTTTCGAGATAGAGTCTCACTGTGTTACCCAGG
Transcript ID List	ENST00000258405.9; ENST00000447280.6; ENST00000409304.5; ENST00000432738.5; ENST00000409840.7
External Link	RMBase: RNA-editing_site_83875

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002517		Click to Show/Hide the Full List
mod site	chr2:224001741-224001742:-		[3]
Sequence	CCTCATGACAACATCGTGATCTCTCCCCATGGGATTGCGTC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000409304.5; ENST00000432738.5; ENST00000258405.9; ENST00000454956.1; ENST00000447280.6; ENST00000409840.7; ENST00000489065.1
External Link	RMBase: m5C_site_27916

N6-methyladenosine (m6A)

In total 46 m6A sequence/site(s) in this target gene
mod ID: M6ASITE050324		Click to Show/Hide the Full List
mod site	chr2:223975190-223975191:-		[4]
Sequence	TTTGCATTTTTGTATTTTGTACAAAGTAAAAATAAACTGTT
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000258405.9; ENST00000409304.5; ENST00000473202.1; ENST00000409840.7
External Link	RMBase: m6A_site_512963
mod ID: M6ASITE050325		Click to Show/Hide the Full List
mod site	chr2:223975220-223975221:-		[4]
Sequence	GCCTGTCACTACTGGTCTGTACTCCTTGGATTTGCATTTTT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000409840.7; ENST00000473202.1; ENST00000258405.9; ENST00000409304.5
External Link	RMBase: m6A_site_512964
mod ID: M6ASITE050326		Click to Show/Hide the Full List
mod site	chr2:223975263-223975264:-		[5]
Sequence	AAAAACTCCTGTCTTGCTAGACAAGGTTGCTGTTGTGCAGT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409304.5; ENST00000473202.1; ENST00000258405.9; ENST00000409840.7
External Link	RMBase: m6A_site_512965
mod ID: M6ASITE050327		Click to Show/Hide the Full List
mod site	chr2:223975463-223975464:-		[4]
Sequence	AATGTTTTATGGTAGCTTTTACTTTTTATGAAAAAAAAATT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000473202.1; ENST00000409304.5; ENST00000258405.9; ENST00000409840.7
External Link	RMBase: m6A_site_512966
mod ID: M6ASITE050328		Click to Show/Hide the Full List
mod site	chr2:223975494-223975495:-		[4]
Sequence	GAAGAAATTTAATCAGTGTGACAGAAAAAAAAATGTTTTAT
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000409304.5; ENST00000473202.1; ENST00000258405.9; ENST00000409840.7
External Link	RMBase: m6A_site_512967
mod ID: M6ASITE050329		Click to Show/Hide the Full List
mod site	chr2:223975590-223975591:-		[5]
Sequence	CTGAACTGTTACCTAGGTTAACAACCCTGTTGAGTATTTGC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000473202.1; ENST00000409304.5; ENST00000409840.7; ENST00000258405.9
External Link	RMBase: m6A_site_512968
mod ID: M6ASITE050330		Click to Show/Hide the Full List
mod site	chr2:223975600-223975601:-		[4]
Sequence	CTTTAAACTACTGAACTGTTACCTAGGTTAACAACCCTGTT
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000409304.5; ENST00000409840.7; ENST00000473202.1; ENST00000258405.9
External Link	RMBase: m6A_site_512969
mod ID: M6ASITE050331		Click to Show/Hide the Full List
mod site	chr2:223975606-223975607:-		[6]
Sequence	AAGATTCTTTAAACTACTGAACTGTTACCTAGGTTAACAAC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409840.7; ENST00000409304.5; ENST00000258405.9; ENST00000473202.1
External Link	RMBase: m6A_site_512970
mod ID: M6ASITE050332		Click to Show/Hide the Full List
mod site	chr2:223975614-223975615:-		[6]
Sequence	ATGTCTAAAAGATTCTTTAAACTACTGAACTGTTACCTAGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000409304.5; ENST00000258405.9; ENST00000473202.1; ENST00000409840.7
External Link	RMBase: m6A_site_512971
mod ID: M6ASITE050333		Click to Show/Hide the Full List
mod site	chr2:223975662-223975663:-		[4]
Sequence	CAGGATGGCTGGAACACTGTACTGAGGAATGAATAGAAAGG
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000409840.7; ENST00000473202.1; ENST00000409304.5; ENST00000258405.9
External Link	RMBase: m6A_site_512972
mod ID: M6ASITE050334		Click to Show/Hide the Full List
mod site	chr2:223975669-223975670:-		[6]
Sequence	AAACAAGCAGGATGGCTGGAACACTGTACTGAGGAATGAAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000409840.7; ENST00000409304.5; ENST00000258405.9; ENST00000473202.1
External Link	RMBase: m6A_site_512973
mod ID: M6ASITE050335		Click to Show/Hide the Full List
mod site	chr2:223975687-223975688:-		[6]
Sequence	GGAGGTATTGGAGGGAAAAAACAAGCAGGATGGCTGGAACA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000409840.7; ENST00000447280.6; ENST00000409304.5; ENST00000473202.1; ENST00000258405.9
External Link	RMBase: m6A_site_512974
mod ID: M6ASITE050336		Click to Show/Hide the Full List
mod site	chr2:223975769-223975770:-		[5]
Sequence	GTTCTGTTAAATATTTTTGTACATCGCTTCTTTTTCAAAAC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409304.5; ENST00000258405.9; ENST00000447280.6; ENST00000473202.1; ENST00000409840.7
External Link	RMBase: m6A_site_512975
mod ID: M6ASITE050337		Click to Show/Hide the Full List
mod site	chr2:223975833-223975834:-		[4]
Sequence	AGAAACCATGCAAAGCAACGACTACTTTGCTACGAAGAAAG
Motif Score	3.287565476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000409304.5; ENST00000258405.9; ENST00000473202.1; ENST00000409840.7; ENST00000447280.6; ENST00000478966.1
External Link	RMBase: m6A_site_512976
mod ID: M6ASITE050338		Click to Show/Hide the Full List
mod site	chr2:223975836-223975837:-		[4]
Sequence	AAAAGAAACCATGCAAAGCAACGACTACTTTGCTACGAAGA
Motif Score	2.147845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000409304.5; ENST00000473202.1; ENST00000258405.9; ENST00000478966.1; ENST00000447280.6; ENST00000409840.7
External Link	RMBase: m6A_site_512977
mod ID: M6ASITE050339		Click to Show/Hide the Full List
mod site	chr2:223975849-223975850:-		[6]
Sequence	CTGAAGAGTATACAAAAGAAACCATGCAAAGCAACGACTAC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000447280.6; ENST00000409304.5; ENST00000258405.9; ENST00000478966.1; ENST00000409840.7; ENST00000473202.1
External Link	RMBase: m6A_site_512978
mod ID: M6ASITE050340		Click to Show/Hide the Full List
mod site	chr2:223975858-223975859:-		[5]
Sequence	AAACAAACCCTGAAGAGTATACAAAAGAAACCATGCAAAGC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409304.5; ENST00000447280.6; ENST00000473202.1; ENST00000478966.1; ENST00000258405.9; ENST00000409840.7
External Link	RMBase: m6A_site_512979
mod ID: M6ASITE050341		Click to Show/Hide the Full List
mod site	chr2:223975876-223975877:-		[6]
Sequence	GTTATTCATGGGGCAGATAAACAAACCCTGAAGAGTATACA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000258405.9; ENST00000478966.1; ENST00000409840.7; ENST00000409304.5; ENST00000473202.1; ENST00000447280.6
External Link	RMBase: m6A_site_512980
mod ID: M6ASITE050342		Click to Show/Hide the Full List
mod site	chr2:223977581-223977582:-		[6]
Sequence	GCCTCCCTGGTTTATAGTAGACAGACCTTTTCTGTTTTTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000478966.1; ENST00000473202.1; ENST00000447280.6; ENST00000258405.9; ENST00000409840.7; ENST00000409304.5
External Link	RMBase: m6A_site_512981
mod ID: M6ASITE050343		Click to Show/Hide the Full List
mod site	chr2:223980313-223980314:-		[5]
Sequence	GAACCAAAGCTTCAGCAGCAACAAGTAAGCACTGGGTCACG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000447280.6; ENST00000409304.5; ENST00000473202.1; ENST00000409840.7; ENST00000478966.1; ENST00000258405.9
External Link	RMBase: m6A_site_512982
mod ID: M6ASITE050344		Click to Show/Hide the Full List
mod site	chr2:223982721-223982722:-		[5]
Sequence	GAAAGTTCTTGGCATTACTGACATGTTTGATTCATCAAAGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000447280.6; ENST00000258405.9; ENST00000473202.1; ENST00000409840.7; ENST00000478966.1; ENST00000409304.5
External Link	RMBase: m6A_site_512983
mod ID: M6ASITE050345		Click to Show/Hide the Full List
mod site	chr2:223982776-223982777:-		[7]
Sequence	TCTGCTTTCATGCTAGGTTCACAGCTGTAGCACAAACAGAT
Motif Score	2.047297619
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000473202.1; ENST00000409840.7; ENST00000447280.6; ENST00000478966.1; ENST00000409304.5; ENST00000258405.9
External Link	RMBase: m6A_site_512984
mod ID: M6ASITE050346		Click to Show/Hide the Full List
mod site	chr2:223984802-223984803:-		[8]
Sequence	CATCAGCACCAAGACCATAGACAGCTGGATGAGCATCATGG
Motif Score	2.897386905
Cell/Tissue List	HepG2; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000409304.5; ENST00000258405.9; ENST00000478966.1; ENST00000447280.6; ENST00000409840.7
External Link	RMBase: m6A_site_512985
mod ID: M6ASITE050347		Click to Show/Hide the Full List
mod site	chr2:223984809-223984810:-		[8]
Sequence	TCCCACACATCAGCACCAAGACCATAGACAGCTGGATGAGC
Motif Score	2.876744048
Cell/Tissue List	HepG2; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000432738.5; ENST00000447280.6; ENST00000258405.9; ENST00000409304.5; ENST00000478966.1; ENST00000409840.7
External Link	RMBase: m6A_site_512986
mod ID: M6ASITE050348		Click to Show/Hide the Full List
mod site	chr2:223984825-223984826:-		[5]
Sequence	CCGCTGTCTGCCATCATCCCACACATCAGCACCAAGACCAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409304.5; ENST00000258405.9; ENST00000478966.1; ENST00000409840.7; ENST00000432738.5; ENST00000447280.6
External Link	RMBase: m6A_site_512987
mod ID: M6ASITE050349		Click to Show/Hide the Full List
mod site	chr2:223984906-223984907:-		[8]
Sequence	TTATGGTACAACTTCATTGAACTGCCCTACCACGGGGAAAG
Motif Score	3.373380952
Cell/Tissue List	HepG2; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000409304.5; ENST00000432738.5; ENST00000447280.6; ENST00000258405.9; ENST00000409840.7; ENST00000478966.1
External Link	RMBase: m6A_site_512988
mod ID: M6ASITE050350		Click to Show/Hide the Full List
mod site	chr2:223984919-223984920:-		[5]
Sequence	TGCCCCCAATGATTTATGGTACAACTTCATTGAACTGCCCT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000258405.9; ENST00000432738.5; ENST00000409840.7; ENST00000478966.1; ENST00000447280.6; ENST00000409304.5
External Link	RMBase: m6A_site_512989
mod ID: M6ASITE050351		Click to Show/Hide the Full List
mod site	chr2:223984944-223984945:-		[5]
Sequence	TTCTGATTTCTTTAGGGTCGACAAGTGCCCCCAATGATTTA
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000258405.9; ENST00000409304.5; ENST00000447280.6; ENST00000409840.7; ENST00000478966.1; ENST00000432738.5
External Link	RMBase: m6A_site_512990
mod ID: M6ASITE050352		Click to Show/Hide the Full List
mod site	chr2:223984970-223984971:-		[9]
Sequence	AGTCAACAAGGATACACTGAACCTGCTTCTGATTTCTTTAG
Motif Score	2.930744048
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000432738.5; ENST00000478966.1; ENST00000409304.5; ENST00000447280.6; ENST00000258405.9; ENST00000409840.7
External Link	RMBase: m6A_site_512991
mod ID: M6ASITE050353		Click to Show/Hide the Full List
mod site	chr2:223991885-223991886:-		[5]
Sequence	ATCACGGTTCCAACCCGAGAACACAAAGAAACGCACTTTCG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000447280.6; ENST00000409840.7; ENST00000432738.5; ENST00000409304.5; ENST00000258405.9
External Link	RMBase: m6A_site_512992
mod ID: M6ASITE050354		Click to Show/Hide the Full List
mod site	chr2:223991990-223991991:-		[5]
Sequence	TGGCTTCACAGATATGATTGACAATCTGCTGTCCCCAGATC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409840.7; ENST00000258405.9; ENST00000432738.5; ENST00000409304.5; ENST00000447280.6
External Link	RMBase: m6A_site_512993
mod ID: M6ASITE050355		Click to Show/Hide the Full List
mod site	chr2:223998120-223998121:-		[6]
Sequence	ATGCATGGGTTAAAAATGAAACCAGGGGTGAGTGGCCGCAG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000447280.6; ENST00000432738.5; ENST00000409304.5; ENST00000409840.7; ENST00000258405.9
External Link	RMBase: m6A_site_512994
mod ID: M6ASITE050356		Click to Show/Hide the Full List
mod site	chr2:223998176-223998177:-		[6]
Sequence	GTGTGAGGTCCGGAATGTGAACTTTGAGGATCCAGCCTCTG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409304.5; ENST00000258405.9; ENST00000409840.7; ENST00000447280.6; ENST00000432738.5
External Link	RMBase: m6A_site_512995
mod ID: M6ASITE050357		Click to Show/Hide the Full List
mod site	chr2:223998212-223998213:-		[6]
Sequence	AGTGCCTTTTGTTACAAGGAACAAAGATGTGTTCCAGTGTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000432738.5; ENST00000409304.5; ENST00000258405.9; ENST00000447280.6; ENST00000409840.7
External Link	RMBase: m6A_site_512996
mod ID: M6ASITE050358		Click to Show/Hide the Full List
mod site	chr2:223998219-223998220:-		[5]
Sequence	AAATTGAAGTGCCTTTTGTTACAAGGAACAAAGATGTGTTC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000258405.9; ENST00000409840.7; ENST00000409304.5; ENST00000447280.6; ENST00000432738.5
External Link	RMBase: m6A_site_512997
mod ID: M6ASITE050359		Click to Show/Hide the Full List
mod site	chr2:223998284-223998285:-		[6]
Sequence	CGTCTCCAAGAAGAATAAAGACATTGTGACAGTGGCTAACG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409840.7; ENST00000432738.5; ENST00000447280.6; ENST00000409304.5; ENST00000258405.9
External Link	RMBase: m6A_site_512998
mod ID: M6ASITE050360		Click to Show/Hide the Full List
mod site	chr2:223998314-223998315:-		[5]
Sequence	TAAAATATTAAAGAAGATCAACAAGGCCATCGTCTCCAAGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409840.7; ENST00000432738.5; ENST00000447280.6; ENST00000409304.5; ENST00000258405.9
External Link	RMBase: m6A_site_512999
mod ID: M6ASITE050361		Click to Show/Hide the Full List
mod site	chr2:224001751-224001752:-		[5]
Sequence	GAAGTCGAGGCCTCATGACAACATCGTGATCTCTCCCCATG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000447280.6; ENST00000409840.7; ENST00000432738.5; ENST00000258405.9; ENST00000489065.1; ENST00000454956.1; ENST00000409304.5
External Link	RMBase: m6A_site_513000
mod ID: M6ASITE050362		Click to Show/Hide the Full List
mod site	chr2:224001802-224001803:-		[5]
Sequence	TCTCGAGGAACTAGGCTCCAACACGGGGATCCAGGTTTTCA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000454956.1; ENST00000423446.1; ENST00000432738.5; ENST00000258405.9; ENST00000409840.7; ENST00000489065.1; ENST00000447280.6; ENST00000409304.5
External Link	RMBase: m6A_site_513001
mod ID: M6ASITE050363		Click to Show/Hide the Full List
mod site	chr2:224001813-224001814:-		[6]
Sequence	AATCCTCTGTCTCTCGAGGAACTAGGCTCCAACACGGGGAT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409304.5; ENST00000423446.1; ENST00000432738.5; ENST00000489065.1; ENST00000447280.6; ENST00000409840.7; ENST00000454956.1; ENST00000258405.9
External Link	RMBase: m6A_site_513002
mod ID: M6ASITE050364		Click to Show/Hide the Full List
mod site	chr2:224001895-224001896:-		[6]
Sequence	CTTGGTGGAAGGAACCATGAACTGGCATCTCCCCCTCTTCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409840.7; ENST00000489065.1; ENST00000454956.1; ENST00000409304.5; ENST00000258405.9; ENST00000432738.5; ENST00000447280.6; ENST00000423446.1
External Link	RMBase: m6A_site_513003
mod ID: M6ASITE050365		Click to Show/Hide the Full List
mod site	chr2:224001902-224001903:-		[6]
Sequence	GGTCGTCCTTGGTGGAAGGAACCATGAACTGGCATCTCCCC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409840.7; ENST00000447280.6; ENST00000489065.1; ENST00000409304.5; ENST00000423446.1; ENST00000258405.9; ENST00000432738.5; ENST00000454956.1
External Link	RMBase: m6A_site_513004
mod ID: M6ASITE050366		Click to Show/Hide the Full List
mod site	chr2:224010383-224010384:-		[6]
Sequence	TGTGTCTTTTCATTGAAGGGACCATTTGGATGTTGCTGCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000423446.1; ENST00000409840.7; ENST00000454956.1; ENST00000447280.6; ENST00000489065.1; ENST00000258405.9; ENST00000409304.5; ENST00000432738.5
External Link	RMBase: m6A_site_513005
mod ID: M6ASITE050367		Click to Show/Hide the Full List
mod site	chr2:224013879-224013880:-		[6]
Sequence	ACATGCACACACTACACTGAACCTCCTGCAACAAGCACTGC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454956.1; ENST00000447280.6; ENST00000423446.1; ENST00000432738.5; ENST00000409304.5; ENST00000258405.9; ENST00000489065.1; ENST00000409840.7
External Link	RMBase: m6A_site_513006
mod ID: M6ASITE050368		Click to Show/Hide the Full List
mod site	chr2:224013899-224013900:-		[6]
Sequence	AGTTTGGCAGCTGGAGGTGGACATGCACACACTACACTGAA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000447280.6; ENST00000409304.5; ENST00000409840.7; ENST00000432738.5; ENST00000454956.1; ENST00000423446.1; ENST00000258405.9; ENST00000489065.1
External Link	RMBase: m6A_site_513007
mod ID: M6ASITE050369		Click to Show/Hide the Full List
mod site	chr2:224039166-224039167:-		[10]
Sequence	CGACTCCCCGCGCCGCCGAGACCAGGCTCCCGCTCCGGTTG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000258405.9; ENST00000489065.1; ENST00000409304.5; ENST00000454956.1
External Link	RMBase: m6A_site_513008

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000077		Click to Show/Hide the Full List
mod site	chr2:224001720-224001721:-		[11]
Sequence	TCTCCCCATGGGATTGCGTCGGTCCTGGGGATGCTTCAGCT
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000409840.7; ENST00000258405.9; ENST00000454956.1; ENST00000409304.5; ENST00000432738.5; ENST00000447280.6; ENST00000489065.1
External Link	RMBase: m7G_site_553

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000151		Click to Show/Hide the Full List
mod site	chr2:223991897-223991898:-		[12]
Sequence	GGGTCTGTGGAAATCACGGTTCCAACCCGAGAACACAAAGA
Transcript ID List	ENST00000432738.5; ENST00000447280.6; ENST00000409304.5; ENST00000409840.7; ENST00000258405.9
External Link	RMBase: Pseudo_site_2812

Ref 1	YTHDF2 reduction fuels inflammation and vascular abnormalization in hepatocellular carcinoma. Mol Cancer. 2019 Nov 18;18(1):163. doi: 10.1186/s12943-019-1082-3.
Ref 2	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 9	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 10	RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun. 2019 May 6;10(1):2065. doi: 10.1038/s41467-019-09865-9.
Ref 11	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.
Ref 12	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map