m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00265)

Target Name	Trans-acting T-cell-specific transcription factor GATA-3 (GATA3)
Synonyms	GATA-binding factor 3 Click to Show/Hide
Gene Name	GATA3
Chromosomal Location	10p14
Function	Transcriptional activator which binds to the enhancer of the T-cell receptor alpha and delta genes. Binds to the consensus sequence 5'-AGATAG-3'. Required for the T-helper 2 (Th2) differentiation process following immune and inflammatory responses. Positively regulates ASB2 expression (By similarity). Click to Show/Hide
Gene ID	2625
Uniprot ID	GATA3_HUMAN
HGNC ID	HGNC:4172
KEGG ID	hsa:2625

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

GATA3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Protein virilizer homolog (VIRMA) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	KIAA1429 induced m6A methylation on the 3' UTR of Trans-acting T-cell-specific transcription factor GATA-3 (GATA3) pre-mRNA, leading to the separation of the RNA-binding protein HuR and the degradation of GATA3 pre-mRNA. KIAA1429 was considerably upregulated in Hepatocellular carcinoma tissues.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Cell Process	Cell proliferation and metastasis
In-vitro Model	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	HEK293T	Normal	Homo sapiens	CVCL_0063
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	SK-HEP-1	Liver and intrahepatic bile duct epithelial neoplasm	Homo sapiens	CVCL_0525
	SNU-182	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0090
	SNU-449	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0454

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	KIAA1429 induced m6A methylation on the 3' UTR of Trans-acting T-cell-specific transcription factor GATA-3 (GATA3) pre-mRNA, leading to the separation of the RNA-binding protein HuR and the degradation of GATA3 pre-mRNA. KIAA1429 was considerably upregulated in Hepatocellular carcinoma tissues.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Protein virilizer homolog (VIRMA)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell proliferation and metastasis
In-vitro Model	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	HEK293T	Normal	Homo sapiens	CVCL_0063
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	SK-HEP-1	Liver and intrahepatic bile duct epithelial neoplasm	Homo sapiens	CVCL_0525
	SNU-182	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0090
	SNU-449	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0454

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Protein virilizer homolog (VIRMA)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05057		Crosstalk Info
Epigenetic Regulator	GATA3 antisense RNA 1 (GATA3-AS1)
Regulated Target	Protein virilizer homolog (VIRMA)
Crosstalk relationship	ncRNA → m6A
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00265)

Trans-acting T-cell-specific transcription factor GATA-3 (GATA3)

N6-methyladenosine (m6A)

In total 38 m6A sequence/site(s) in this target gene
mod ID: M6ASITE095362		Click to Show/Hide the Full List
mod site	chr10:8053667-8053668:+		[4]
Sequence	GCGCAGAGCGTGGCCTGGAGACCCGCGAGCCGGGGAAGGTC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000643001.1; ENST00000481743.2
External Link	RMBase: m6A_site_92130
mod ID: M6ASITE095363		Click to Show/Hide the Full List
mod site	chr10:8053731-8053732:+		[4]
Sequence	CGGGGTTGGGGTCGGTGCAGACCGAGGGCTGGTTTCCTTGA
Motif Score	2.876744048
Cell/Tissue List	HeLa; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643001.1; ENST00000481743.2
External Link	RMBase: m6A_site_92131
mod ID: M6ASITE095364		Click to Show/Hide the Full List
mod site	chr10:8054689-8054690:+		[4]
Sequence	CGCGCCACAGCTGTCTGCGAACACTGAGCTGCCTGGCGCCG
Motif Score	2.951386905
Cell/Tissue List	HeLa; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000645492.1; ENST00000643001.1; ENST00000481743.2
External Link	RMBase: m6A_site_92132
mod ID: M6ASITE095365		Click to Show/Hide the Full List
mod site	chr10:8054814-8054815:+		[4]
Sequence	AGAGACGGAGGGAGAGCGAGACAGAGCGAGCAACGCAATCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; Huh7; Jurkat; CD4T; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000645492.1; rmsk_3230106; ENST00000643001.1; ENST00000379328.9; ENST00000481743.2
External Link	RMBase: m6A_site_92133
mod ID: M6ASITE095366		Click to Show/Hide the Full List
mod site	chr10:8055301-8055302:+		[4]
Sequence	TGCAGGTGACCCGAGGAGGGACTCCGCCTCCGAGCGGCTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; Jurkat; CD4T; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000643001.1; ENST00000346208.4; ENST00000645492.1; ENST00000379328.9; ENST00000481743.2
External Link	RMBase: m6A_site_92134
mod ID: M6ASITE095367		Click to Show/Hide the Full List
mod site	chr10:8055324-8055325:+		[5]
Sequence	CCGCCTCCGAGCGGCTGAGGACCCCGGTGCAGAGGAGCCTG
Motif Score	3.622404762
Cell/Tissue List	Jurkat; CD4T; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000481743.2; ENST00000645492.1; ENST00000346208.4; ENST00000643001.1; ENST00000379328.9
External Link	RMBase: m6A_site_92135
mod ID: M6ASITE095368		Click to Show/Hide the Full List
mod site	chr10:8055478-8055479:+		[6]
Sequence	TCCAAGATAATTTTTAAAAAACCTTCTCCTTTGCTCACCTT
Motif Score	2.185083333
Cell/Tissue List	HEK293T; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000481743.2; ENST00000379328.9; ENST00000643001.1; ENST00000645492.1; ENST00000346208.4
External Link	RMBase: m6A_site_92136
mod ID: M6ASITE095369		Click to Show/Hide the Full List
mod site	chr10:8055591-8055592:+		[7]
Sequence	CCCCCCGACCTCCCAGGCGGACCGCCCTCCCTCCCCGCGCG
Motif Score	3.622404762
Cell/Tissue List	HEK293T; MT4; Huh7; Jurkat
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000481743.2; ENST00000346208.4; ENST00000645492.1; ENST00000643001.1; ENST00000379328.9
External Link	RMBase: m6A_site_92137
mod ID: M6ASITE095370		Click to Show/Hide the Full List
mod site	chr10:8055671-8055672:+		[7]
Sequence	GGCCATGGAGGTGACGGCGGACCAGCCGCGCTGGGTGAGCC
Motif Score	3.622404762
Cell/Tissue List	MT4; Jurkat; CD4T; HEK293T
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000481743.2; ENST00000346208.4; ENST00000643001.1; ENST00000645492.1; ENST00000379328.9
External Link	RMBase: m6A_site_92138
mod ID: M6ASITE095371		Click to Show/Hide the Full List
mod site	chr10:8055728-8055729:+		[7]
Sequence	GCTCAACGGGCAGCACCCGGACACGCACCACCCGGGCCTCA
Motif Score	3.643047619
Cell/Tissue List	MT4; Jurkat; HEK293T
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000643001.1; ENST00000346208.4; ENST00000645492.1; ENST00000379328.9; ENST00000481743.2
External Link	RMBase: m6A_site_92139
mod ID: M6ASITE095372		Click to Show/Hide the Full List
mod site	chr10:8055851-8055852:+		[4]
Sequence	CGTCCCGCCCTACTACGGAAACTCGGTCAGGGCCACGGTGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000481743.2; ENST00000346208.4; ENST00000643001.1; ENST00000379328.9; ENST00000645492.1
External Link	RMBase: m6A_site_92140
mod ID: M6ASITE095373		Click to Show/Hide the Full List
mod site	chr10:8058553-8058554:+		[4]
Sequence	GCCGAAGGACGTCTCCCCGGACCCATCGCTGTCCACCCCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD4T
Seq Type List	m6A-seq
Transcript ID List	ENST00000346208.4; ENST00000461472.1; ENST00000379328.9; ENST00000645492.1
External Link	RMBase: m6A_site_92141
mod ID: M6ASITE095374		Click to Show/Hide the Full List
mod site	chr10:8058758-8058759:+		[7]
Sequence	GTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCT
Motif Score	4.065041667
Cell/Tissue List	MT4; CD4T
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000645492.1; ENST00000379328.9; ENST00000461472.1; ENST00000346208.4
External Link	RMBase: m6A_site_92142
mod ID: M6ASITE095375		Click to Show/Hide the Full List
mod site	chr10:8064010-8064011:+		[7]
Sequence	AGAAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCC
Motif Score	3.373380952
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000645492.1; ENST00000379328.9; ENST00000461472.1
External Link	RMBase: m6A_site_92143
mod ID: M6ASITE095376		Click to Show/Hide the Full List
mod site	chr10:8064056-8064057:+		[7]
Sequence	TGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTG
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000645492.1; ENST00000461472.1; ENST00000346208.4
External Link	RMBase: m6A_site_92144
mod ID: M6ASITE095377		Click to Show/Hide the Full List
mod site	chr10:8064101-8064102:+		[7]
Sequence	CTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAA
Motif Score	3.643047619
Cell/Tissue List	MT4; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000461472.1; ENST00000346208.4; ENST00000379328.9; ENST00000645492.1
External Link	RMBase: m6A_site_92145
mod ID: M6ASITE095378		Click to Show/Hide the Full List
mod site	chr10:8064106-8064107:+		[7]
Sequence	TCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCA
Motif Score	2.930744048
Cell/Tissue List	MT4; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000645492.1; ENST00000379328.9; ENST00000346208.4; ENST00000461472.1
External Link	RMBase: m6A_site_92146
mod ID: M6ASITE095379		Click to Show/Hide the Full List
mod site	chr10:8069506-8069507:+		[7]
Sequence	AGCAGGGACGTCCTGTGCGAACTGTCAGACCACCACAACCA
Motif Score	3.373380952
Cell/Tissue List	MT4; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000461472.1; ENST00000645492.1; ENST00000346208.4
External Link	RMBase: m6A_site_92147
mod ID: M6ASITE095380		Click to Show/Hide the Full List
mod site	chr10:8069514-8069515:+		[8]
Sequence	CGTCCTGTGCGAACTGTCAGACCACCACAACCACACTCTGG
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000645492.1; ENST00000461472.1; ENST00000379328.9
External Link	RMBase: m6A_site_92148
mod ID: M6ASITE095381		Click to Show/Hide the Full List
mod site	chr10:8069554-8069555:+		[8]
Sequence	GAGGAGGAATGCCAATGGGGACCCTGTCTGCAATGCCTGTG
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000461472.1; ENST00000346208.4; ENST00000645492.1
External Link	RMBase: m6A_site_92149
mod ID: M6ASITE095382		Click to Show/Hide the Full List
mod site	chr10:8073742-8073743:+		[9]
Sequence	ATTGATCTTTGTTTAGATTAACAGACCCCTGACTATGAAGA
Motif Score	2.168095238
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000379328.9; ENST00000461472.1; ENST00000346208.4; ENST00000645492.1
External Link	RMBase: m6A_site_92150
mod ID: M6ASITE095383		Click to Show/Hide the Full List
mod site	chr10:8073746-8073747:+		[6]
Sequence	ATCTTTGTTTAGATTAACAGACCCCTGACTATGAAGAAGGA
Motif Score	2.876744048
Cell/Tissue List	HEK293T; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000645492.1; ENST00000346208.4; ENST00000379328.9; ENST00000461472.1
External Link	RMBase: m6A_site_92151
mod ID: M6ASITE095384		Click to Show/Hide the Full List
mod site	chr10:8073777-8073778:+		[6]
Sequence	TGAAGAAGGAAGGCATCCAGACCAGAAACCGAAAAATGTCT
Motif Score	2.876744048
Cell/Tissue List	HEK293T; A549; Huh7; Jurkat
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000379328.9; ENST00000461472.1; ENST00000346208.4; ENST00000645492.1
External Link	RMBase: m6A_site_92152
mod ID: M6ASITE095385		Click to Show/Hide the Full List
mod site	chr10:8073784-8073785:+		[6]
Sequence	GGAAGGCATCCAGACCAGAAACCGAAAAATGTCTAGCAAAT
Motif Score	2.185083333
Cell/Tissue List	HEK293T; A549; Huh7; Jurkat
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000645492.1; ENST00000346208.4; ENST00000461472.1; ENST00000379328.9
External Link	RMBase: m6A_site_92153
mod ID: M6ASITE095386		Click to Show/Hide the Full List
mod site	chr10:8073841-8073842:+		[4]
Sequence	AGTGCATGACTCACTGGAGGACTTCCCCAAGAACAGCTCGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; MT4; Huh7; Jurkat; CD4T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000645492.1; ENST00000379328.9; ENST00000461472.1
External Link	RMBase: m6A_site_92154
mod ID: M6ASITE095387		Click to Show/Hide the Full List
mod site	chr10:8073853-8073854:+		[4]
Sequence	ACTGGAGGACTTCCCCAAGAACAGCTCGTTTAACCCGGCCG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; MT4; Huh7; Jurkat; CD4T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000461472.1; ENST00000379328.9; ENST00000346208.4; ENST00000645492.1
External Link	RMBase: m6A_site_92155
mod ID: M6ASITE095388		Click to Show/Hide the Full List
mod site	chr10:8073884-8073885:+		[4]
Sequence	AACCCGGCCGCCCTCTCCAGACACATGTCCTCCCTGAGCCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; MT4; Huh7; Jurkat; CD4T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000461472.1; ENST00000346208.4; ENST00000645492.1; ENST00000379328.9
External Link	RMBase: m6A_site_92156
mod ID: M6ASITE095389		Click to Show/Hide the Full List
mod site	chr10:8073983-8073984:+		[4]
Sequence	CCATCCAGCCTGTCCTTTGGACCACACCACCCCTCCAGCAT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; MT4; Huh7; Jurkat; CD4T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000346208.4; ENST00000645492.1; ENST00000461472.1
External Link	RMBase: m6A_site_92157
mod ID: M6ASITE095390		Click to Show/Hide the Full List
mod site	chr10:8074214-8074215:+		[4]
Sequence	GTTCCAACCACTGAATCTGGACCCCATCTGTGAATAAGCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; Huh7; HEK293A-TOA; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000645492.1; ENST00000379328.9
External Link	RMBase: m6A_site_92158
mod ID: M6ASITE095391		Click to Show/Hide the Full List
mod site	chr10:8074258-8074259:+		[10]
Sequence	TGACTCATATCCCCTATTTAACAGGGTCTCTAGTGCTGTGA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T; CD8T
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000379328.9; ENST00000645492.1; ENST00000346208.4
External Link	RMBase: m6A_site_92159
mod ID: M6ASITE095392		Click to Show/Hide the Full List
mod site	chr10:8074294-8074295:+		[4]
Sequence	TGTGAAAAAAAAAATGCTGAACATTGCATATAACTTATATT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; GM12878; Huh7; HEK293A-TOA; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000645492.1; ENST00000346208.4; ENST00000379328.9
External Link	RMBase: m6A_site_92160
mod ID: M6ASITE095393		Click to Show/Hide the Full List
mod site	chr10:8074423-8074424:+		[4]
Sequence	AGTGTGGAAATTAAGAAGAAACTAGGTCTGATATTCAAATG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000645492.1; ENST00000379328.9; ENST00000346208.4
External Link	RMBase: m6A_site_92161
mod ID: M6ASITE095394		Click to Show/Hide the Full List
mod site	chr10:8074445-8074446:+		[4]
Sequence	TAGGTCTGATATTCAAATGGACAAACTGCCAGTTTTGTTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000645492.1; ENST00000346208.4
External Link	RMBase: m6A_site_92162
mod ID: M6ASITE095395		Click to Show/Hide the Full List
mod site	chr10:8074680-8074681:+		[8]
Sequence	TAGGCCTACATGCTTTGTGAACAAGTCCCTGTAATTGTTGT
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000379328.9; ENST00000645492.1
External Link	RMBase: m6A_site_92163
mod ID: M6ASITE095396		Click to Show/Hide the Full List
mod site	chr10:8074762-8074763:+		[9]
Sequence	GATTTATTTCATCATATTATACAGACCGAACTGTTGTATAA
Motif Score	2.110482143
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000346208.4; ENST00000379328.9; ENST00000645492.1
External Link	RMBase: m6A_site_92164
mod ID: M6ASITE095397		Click to Show/Hide the Full List
mod site	chr10:8074766-8074767:+		[8]
Sequence	TATTTCATCATATTATACAGACCGAACTGTTGTATAAATTT
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379328.9; ENST00000346208.4; ENST00000645492.1
External Link	RMBase: m6A_site_92165
mod ID: M6ASITE095398		Click to Show/Hide the Full List
mod site	chr10:8074771-8074772:+		[8]
Sequence	CATCATATTATACAGACCGAACTGTTGTATAAATTTATTTA
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000645492.1; ENST00000346208.4; ENST00000379328.9
External Link	RMBase: m6A_site_92166
mod ID: M6ASITE095399		Click to Show/Hide the Full List
mod site	chr10:8074807-8074808:+		[8]
Sequence	ATTTACTGCTAGTCTTAAGAACTGCTTTCTTTCGTTTGTTT
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000346208.4; ENST00000645492.1; ENST00000379328.9
External Link	RMBase: m6A_site_92167

Ref 1	US patent application no. 2014,0079,636, Targeted therapeutics.
Ref 2	URL: http://www.guidetopharmacology.org Nucleic Acids Res. 2015 Oct 12. pii: gkv1037. The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. (Target id: 1973).
Ref 3	KIAA1429 contributes to liver cancer progression through N6-methyladenosine-dependent post-transcriptional modification of GATA3. Mol Cancer. 2019 Dec 19;18(1):186. doi: 10.1186/s12943-019-1106-z.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.
Ref 6	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 7	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 10	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map