m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00263)
Target Name Glucose-6-phosphatase catalytic subunit 1 (G6PC/G6PC1)
Synonyms
Glucose-6-phosphatase; G-6-Pase; G6Pase; Glucose-6-phosphatase alpha; G6Pase-alpha; G6PC; G6PT
    Click to Show/Hide
Gene Name G6PC1
Chromosomal Location 17q21.31
Family glucose-6-phosphatase family
Function
Hydrolyzes glucose-6-phosphate to glucose in the endoplasmic reticulum. Forms with the glucose-6-phosphate transporter (SLC37A4/G6PT) the complex responsible for glucose production in the terminal step of glycogenolysis and gluconeogenesis. Hence, it is the key enzyme in homeostatic regulation of blood glucose levels.
    Click to Show/Hide
Gene ID 2538
Uniprot ID
G6PC1_HUMAN
HGNC ID
HGNC:4056
KEGG ID
hsa:2538
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
G6PC1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes.high-glucose stimulation enhances FTO expression, which leads to decreased m6A, and the lower m6A induces methyltransferase upregulation; FTO then triggers the mRNA expression of FOXO1, FASN, Glucose-6-phosphatase catalytic subunit 1 (G6PC/G6PC1), and DGAT2, and these four genes were correlated with glucose and lipid metabolism.
Responsed Disease Diabetes ICD-11: 5A10-5A14
 Disease Info 
Pathway Response Metabolic pathways hsa01100
Glycolysis / Gluconeogenesis hsa00010
Cell Process Lipid metabolism
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
Diabetes [ICD-11: 5A10-5A14]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes.high-glucose stimulation enhances FTO expression, which leads to decreased m6A, and the lower m6A induces methyltransferase upregulation; FTO then triggers the mRNA expression of FOXO1, FASN, Glucose-6-phosphatase catalytic subunit 1 (G6PC/G6PC1), and DGAT2, and these four genes were correlated with glucose and lipid metabolism.
Responsed Disease Diabetes [ICD-11: 5A10-5A14]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Pathway Response Metabolic pathways hsa01100
Glycolysis / Gluconeogenesis hsa00010
Cell Process Lipid metabolism
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00263)
Glucose-6-phosphatase catalytic subunit 1 (G6PC/G6PC1)
N6-methyladenosine (m6A)
In total 5 m6A sequence/site(s) in this target gene
mod ID: M6ASITE033012 Click to Show/Hide the Full List
mod site chr17:42907575-42907576:+ [3]
Sequence GTGTATACTACGTGATGGTCACATCTACTCTTTCCATCTTT
Motif Score 2.047297619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000592383.5; ENST00000253801.6; ENST00000585489.1
External Link RMBase: m6A_site_364621
mod ID: M6ASITE033013 Click to Show/Hide the Full List
mod site chr17:42911523-42911524:+ [3]
Sequence ACTGGTATTTGGAGCAAGTGACATGCCATCCATTCTGCCGT
Motif Score 2.859755952
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000253801.6
External Link RMBase: m6A_site_364622
mod ID: M6ASITE033014 Click to Show/Hide the Full List
mod site chr17:42911621-42911622:+ [3]
Sequence GACTCCAGCCTGCCCTCAGCACAGACTCTTTCAGATGGAGG
Motif Score 2.830589286
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000253801.6
External Link RMBase: m6A_site_364623
mod ID: M6ASITE033015 Click to Show/Hide the Full List
mod site chr17:42912656-42912657:+ [3]
Sequence TCTTTTTTTTTTTTTTTGAGACAGGGTCTCACTATGTTGCC
Motif Score 2.897386905
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000253801.6
External Link RMBase: m6A_site_364624
mod ID: M6ASITE033016 Click to Show/Hide the Full List
mod site chr17:42912748-42912749:+ [3]
Sequence CGTCCCGCGTAGCTGGGACTACAGGTGCAAGCCACTATGTC
Motif Score 2.078666667
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000253801.6
External Link RMBase: m6A_site_364625