m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00262)

Target Name	Far upstream element-binding protein 1 (FUBP1)
Synonyms	FBP; FUSE-binding protein 1; DNA helicase V; hDH V Click to Show/Hide
Gene Name	FUBP1
Chromosomal Location	1p31.1
Function	Regulates MYC expression by binding to a single-stranded far-upstream element (FUSE) upstream of the MYC promoter. May act both as activator and repressor of transcription. Click to Show/Hide
Gene ID	8880
Uniprot ID	FUBP1_HUMAN
HGNC ID	HGNC:4004
KEGG ID	hsa:8880

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FUBP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	DKO-1 cell line	Homo sapiens
Treatment: METTL3 knockdown DKO-1 cell Control: DKO-1 cell		GSE182382
Regulation		logFC: 6.14E-01 p-value: 4.72E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between FUBP1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.31E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	LCAT3 upregulation is attributable to N6-methyladenosine (m6A) modification mediated by methyltransferase like 3 (METTL3), leading to LCAT3 stabilization. LCAT3 as a novel oncogenic lncRNA in the lung, and validated the LCAT3-Far upstream element-binding protein 1 (FUBP1)-MYC axis as a potential therapeutic target for lung adenocarcinomas.
Target Regulation	Up regulation
Responsed Disease	Lung adenocarcinoma		ICD-11: 2C25.0	Disease Info
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0608
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HOP-62	Lung adenocarcinoma	Homo sapiens	CVCL_1285
In-vivo Model	For the in vivo tumorigenicity assay, female BALB/c nude mice (ages 4-5 weeks) were randomly divided into two groups (n = 6/group). Calu1 cells (4 × 10⁶) that had been stably transfected with sh-LCAT3 or scramble were implanted subcutaneously into the nude mice. Tumor growth was measured after one week, and tumor volumes were calculated with the following formula: Volume (cm³) = (length × width²)/2. After four weeks, the mice were euthanized, and the tumors were collected and weighed. For the in vivo tumor invasion assay, 1.2 × 10⁶ scramble or shLCAT3 cells were injected intravenously into the tail vein of nude mice (n = 6/group). 1.5 mg luciferin (Gold Biotech, St Louis, MO, USA) was administered once a week for 4 weeks, to monitor metastases using an IVIS@ Lumina II system (Caliper Life Sciences, Hopkinton, MA, USA).

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	LCAT3 upregulation is attributable to N6-methyladenosine (m6A) modification mediated by methyltransferase like 3 (METTL3), leading to LCAT3 stabilization. LCAT3 as a novel oncogenic lncRNA in the lung, and validated the LCAT3-Far upstream element-binding protein 1 (FUBP1)-MYC axis as a potential therapeutic target for lung adenocarcinomas.
Responsed Disease	Lung adenocarcinoma [ICD-11: 2C25.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	Calu-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0608
	HEK293T	Normal	Homo sapiens	CVCL_0063
	HOP-62	Lung adenocarcinoma	Homo sapiens	CVCL_1285
In-vivo Model	For the in vivo tumorigenicity assay, female BALB/c nude mice (ages 4-5 weeks) were randomly divided into two groups (n = 6/group). Calu1 cells (4 × 10⁶) that had been stably transfected with sh-LCAT3 or scramble were implanted subcutaneously into the nude mice. Tumor growth was measured after one week, and tumor volumes were calculated with the following formula: Volume (cm³) = (length × width²)/2. After four weeks, the mice were euthanized, and the tumors were collected and weighed. For the in vivo tumor invasion assay, 1.2 × 10⁶ scramble or shLCAT3 cells were injected intravenously into the tail vein of nude mice (n = 6/group). 1.5 mg luciferin (Gold Biotech, St Louis, MO, USA) was administered once a week for 4 weeks, to monitor metastases using an IVIS@ Lumina II system (Caliper Life Sciences, Hopkinton, MA, USA).

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00262)

Far upstream element-binding protein 1 (FUBP1)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009083		Click to Show/Hide the Full List
mod site	chr1:77950220-77950221:-		[2]
Sequence	CTGCAGTGAGCCATGATTGCACCGCTGCACTCCAGCCTGGG
Transcript ID List	ENST00000487684.1; ENST00000492405.5; rmsk_171820; ENST00000370767.5; ENST00000492724.1; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: RNA-editing_site_6729
mod ID: A2ISITE009084		Click to Show/Hide the Full List
mod site	chr1:77950316-77950317:-		[3]
Sequence	AAAAGAGAAAAATGTCAGCTAGGCATGGTGGGCCTGTAGTC
Transcript ID List	ENST00000487684.1; ENST00000492724.1; ENST00000492405.5; ENST00000370768.6; rmsk_171820; ENST00000370767.5; ENST00000294623.8
External Link	RMBase: RNA-editing_site_6730
mod ID: A2ISITE009085		Click to Show/Hide the Full List
mod site	chr1:77950410-77950411:-		[2]
Sequence	TCCCAGGACTTTGGGAGGCCAAGGCAGGTGGATCACTTGAG
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000492724.1; ENST00000492405.5; ENST00000294623.8; rmsk_171820; ENST00000487684.1
External Link	RMBase: RNA-editing_site_6731
mod ID: A2ISITE009086		Click to Show/Hide the Full List
mod site	chr1:77953052-77953053:-		[4]
Sequence	ACCTCTGCTTCCTGGGTTCAAGCTATTCTCCTGCCTCAACT
Transcript ID List	ENST00000492724.1; ENST00000294623.8; ENST00000370767.5; ENST00000487684.1; ENST00000370768.6; ENST00000492405.5
External Link	RMBase: RNA-editing_site_6732

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002458		Click to Show/Hide the Full List
mod site	chr1:77964072-77964073:-		[5]
Sequence	AAATTATTACAGACCTTCTTCGAAGTGTTCAGGTTTGATAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m5C_site_2762

N6-methyladenosine (m6A)

In total 85 m6A sequence/site(s) in this target gene
mod ID: M6ASITE033623		Click to Show/Hide the Full List
mod site	chr1:77944188-77944189:-		[6]
Sequence	CTTAGGGAGATGCAGCTTGGACTTGAGGTAAATTGAATACT
Motif Score	4.065041667
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492724.1; ENST00000483894.5; ENST00000492405.5; ENST00000488814.5; ENST00000480673.5; ENST00000474632.5; ENST00000489495.5
External Link	RMBase: m6A_site_36955
mod ID: M6ASITE033624		Click to Show/Hide the Full List
mod site	chr1:77944215-77944216:-		[6]
Sequence	AAATGGCTACTGTGATGGGAACAGTGTCTTAGGGAGATGCA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000492724.1; ENST00000492405.5; ENST00000483894.5; ENST00000480673.5; ENST00000474632.5; ENST00000488814.5; ENST00000489495.5
External Link	RMBase: m6A_site_36956
mod ID: M6ASITE033625		Click to Show/Hide the Full List
mod site	chr1:77944266-77944267:-		[6]
Sequence	GAAAAATGTTCTCTACAGAAACTACCCGTGTGTAAAAAGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000492405.5; ENST00000489495.5; ENST00000474632.5; ENST00000483894.5; ENST00000492724.1; ENST00000480673.5; ENST00000488814.5
External Link	RMBase: m6A_site_36957
mod ID: M6ASITE033626		Click to Show/Hide the Full List
mod site	chr1:77944356-77944357:-		[7]
Sequence	TCAGTGATACCCCTATAGAAACTCTTAAATGTATTTGCGCA
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000474632.5; ENST00000483894.5; ENST00000488814.5; ENST00000492724.1; ENST00000480673.5; ENST00000489495.5; ENST00000492405.5
External Link	RMBase: m6A_site_36958
mod ID: M6ASITE033627		Click to Show/Hide the Full List
mod site	chr1:77944468-77944469:-		[7]
Sequence	TATTTTTTGTTGAGTTAGTGACTTCATTTTTCTTGCCACAA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480673.5; ENST00000492724.1; ENST00000488814.5; ENST00000474632.5; ENST00000483894.5; ENST00000489495.5; ENST00000492405.5
External Link	RMBase: m6A_site_36959
mod ID: M6ASITE033628		Click to Show/Hide the Full List
mod site	chr1:77944639-77944640:-		[7]
Sequence	CTGCCAGTAAAATCAGCTGTACTTAGAAAGTTATCTGTTGT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000488814.5; ENST00000474632.5; ENST00000492724.1; ENST00000492405.5; ENST00000480673.5; ENST00000489495.5; ENST00000483894.5
External Link	RMBase: m6A_site_36960
mod ID: M6ASITE033629		Click to Show/Hide the Full List
mod site	chr1:77944797-77944798:-		[7]
Sequence	TTGATACTAGTTGTTTATAAACATTGTAAAATATATCTTTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480673.5; ENST00000483894.5; ENST00000489495.5; ENST00000488814.5; ENST00000492405.5; ENST00000474632.5; ENST00000492724.1
External Link	RMBase: m6A_site_36961
mod ID: M6ASITE033630		Click to Show/Hide the Full List
mod site	chr1:77944912-77944913:-		[7]
Sequence	AGACAGCTTAGTGTGGTGATACTTAGAATTCTATGGTTTGA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000492724.1; ENST00000489495.5; ENST00000480673.5; ENST00000488814.5; ENST00000474632.5; ENST00000492405.5; ENST00000483894.5
External Link	RMBase: m6A_site_36962
mod ID: M6ASITE033631		Click to Show/Hide the Full List
mod site	chr1:77944930-77944931:-		[7]
Sequence	TGTTTTTAGTTTTTTTTAAGACAGCTTAGTGTGGTGATACT
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000492405.5; ENST00000489495.5; ENST00000492724.1; ENST00000480673.5; ENST00000474632.5; ENST00000483894.5; ENST00000488814.5
External Link	RMBase: m6A_site_36963
mod ID: M6ASITE033632		Click to Show/Hide the Full List
mod site	chr1:77945136-77945137:-		[7]
Sequence	TGAGAATTCTTTTATTCATTACCATAAGCCTTCACTGATAC
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000492724.1; ENST00000489495.5; ENST00000480673.5; ENST00000488814.5; ENST00000474632.5; ENST00000492405.5; ENST00000483894.5
External Link	RMBase: m6A_site_36964
mod ID: M6ASITE033634		Click to Show/Hide the Full List
mod site	chr1:77945260-77945261:-		[7]
Sequence	ATATAAAGGGGCTCATTGAAACTTGAGAGCCTGTTGAGTTT
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000492405.5; ENST00000492724.1; ENST00000488814.5; ENST00000483894.5; ENST00000474632.5; ENST00000489495.5; ENST00000480673.5
External Link	RMBase: m6A_site_36965
mod ID: M6ASITE033645		Click to Show/Hide the Full List
mod site	chr1:77945351-77945352:-		[7]
Sequence	ACTGTTAAATTTCTTAAGTTACATAGTTACTACACCACATT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000488814.5; ENST00000483894.5; ENST00000489495.5; ENST00000492405.5; ENST00000480673.5; ENST00000492724.1; ENST00000474632.5
External Link	RMBase: m6A_site_36966
mod ID: M6ASITE033656		Click to Show/Hide the Full List
mod site	chr1:77945529-77945530:-		[6]
Sequence	TGGTGAGCCGATGAGCATGGACCATAGAAGGGCTCAATGTA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000474632.5; ENST00000492405.5; ENST00000488814.5; ENST00000489495.5; ENST00000492724.1; ENST00000483894.5; ENST00000480673.5
External Link	RMBase: m6A_site_36967
mod ID: M6ASITE033667		Click to Show/Hide the Full List
mod site	chr1:77946699-77946700:-		[6]
Sequence	GTGGTGCATTTATTAATTGAACTGAAGAAGTAGTTCAGTTG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000492405.5; ENST00000294623.8; ENST00000492724.1; ENST00000474632.5; ENST00000488814.5; ENST00000489495.5
External Link	RMBase: m6A_site_36968
mod ID: M6ASITE033678		Click to Show/Hide the Full List
mod site	chr1:77946770-77946771:-		[6]
Sequence	AGAGTAGGGTATTGACGTGAACAATTGCAGTATTTTGCATG
Motif Score	2.951386905
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000489495.5; ENST00000492724.1; ENST00000492405.5; ENST00000294623.8; ENST00000488814.5; ENST00000474632.5
External Link	RMBase: m6A_site_36969
mod ID: M6ASITE033687		Click to Show/Hide the Full List
mod site	chr1:77946970-77946971:-		[6]
Sequence	TTAAAGGAAGAGGTACAAGGACATAAATGTTGAGATTACCT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000474632.5; ENST00000492724.1; ENST00000489495.5; ENST00000294623.8; ENST00000492405.5; ENST00000488814.5
External Link	RMBase: m6A_site_36970
mod ID: M6ASITE033688		Click to Show/Hide the Full List
mod site	chr1:77947211-77947212:-		[7]
Sequence	TATAGCTAAAGAAAACTGATACTTAACAAAGTTGAATAGTA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000492405.5; ENST00000488814.5; ENST00000489495.5; ENST00000492724.1; ENST00000474632.5; ENST00000294623.8
External Link	RMBase: m6A_site_36971
mod ID: M6ASITE033689		Click to Show/Hide the Full List
mod site	chr1:77947822-77947823:-		[6]
Sequence	ACATTGCATCTGCCATTGAAACATAAATGGGGTATGGAAAC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000492405.5; ENST00000488814.5; ENST00000489495.5; ENST00000492724.1; ENST00000294623.8
External Link	RMBase: m6A_site_36972
mod ID: M6ASITE033690		Click to Show/Hide the Full List
mod site	chr1:77947946-77947947:-		[8]
Sequence	ATATGAGTAGTCTAATAAGAACAGTTTTTTTCCATGTGAAG
Motif Score	2.951386905
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000294623.8; ENST00000489495.5; ENST00000492724.1; ENST00000488814.5; ENST00000492405.5
External Link	RMBase: m6A_site_36973
mod ID: M6ASITE033691		Click to Show/Hide the Full List
mod site	chr1:77948144-77948145:-		[9]
Sequence	ATTAAAAACTGCATGTGTGTACAATGATCTTTTGGCATACT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000492405.5; ENST00000489495.5; ENST00000492724.1; ENST00000488814.5; ENST00000294623.8
External Link	RMBase: m6A_site_36974
mod ID: M6ASITE033692		Click to Show/Hide the Full List
mod site	chr1:77948205-77948206:-		[9]
Sequence	ATTGTATTGGCTCTTTCAGCACAAGTAATCCTGATATCTTC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000489495.5; ENST00000294623.8; ENST00000488814.5; ENST00000492405.5; ENST00000492724.1
External Link	RMBase: m6A_site_36975
mod ID: M6ASITE033693		Click to Show/Hide the Full List
mod site	chr1:77948285-77948286:-		[6]
Sequence	ATGAAATATTGAGTTTTTAAACACTGGCATGTTTTTCCCCC
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000489495.5; ENST00000492405.5; ENST00000294623.8; ENST00000488814.5; ENST00000492724.1
External Link	RMBase: m6A_site_36976
mod ID: M6ASITE033694		Click to Show/Hide the Full List
mod site	chr1:77948334-77948335:-		[9]
Sequence	TAGCAATGATAAATTAAGATACATATACACAAATATATAAG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000488814.5; ENST00000492724.1; ENST00000492405.5; ENST00000294623.8
External Link	RMBase: m6A_site_36977
mod ID: M6ASITE033695		Click to Show/Hide the Full List
mod site	chr1:77948408-77948409:-		[6]
Sequence	TTTACAATAAATGATATGAAACCTCCTGTGTCGGTAAGTTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000492405.5; ENST00000370768.6; ENST00000488814.5; ENST00000294623.8; ENST00000370767.5; ENST00000492724.1
External Link	RMBase: m6A_site_36978
mod ID: M6ASITE033696		Click to Show/Hide the Full List
mod site	chr1:77948425-77948426:-		[9]
Sequence	AAATGCCTGTTTTGTGCTTTACAATAAATGATATGAAACCT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000294623.8; ENST00000488814.5; ENST00000492724.1; ENST00000492405.5
External Link	RMBase: m6A_site_36979
mod ID: M6ASITE033697		Click to Show/Hide the Full List
mod site	chr1:77948473-77948474:-		[7]
Sequence	ATGCTTTGTGATATAAATGTACTTTTTCAATGTATACTTTC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000370768.6; ENST00000492724.1; ENST00000370767.5; ENST00000294623.8; ENST00000492405.5; ENST00000488814.5
External Link	RMBase: m6A_site_36980
mod ID: M6ASITE033698		Click to Show/Hide the Full List
mod site	chr1:77948530-77948531:-		[7]
Sequence	TTAGTATTTAGTGTAGATGTACACATTCCAGCAAATGTATT
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000492405.5; ENST00000294623.8; ENST00000370768.6; ENST00000492724.1; ENST00000488814.5; ENST00000370767.5
External Link	RMBase: m6A_site_36981
mod ID: M6ASITE033699		Click to Show/Hide the Full List
mod site	chr1:77948599-77948600:-		[7]
Sequence	TGTACAAAATATCTATCACTACTGATAGGAGGTTAATATTT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000488814.5; ENST00000492724.1; ENST00000370767.5; ENST00000370768.6; ENST00000294623.8; ENST00000492405.5
External Link	RMBase: m6A_site_36982
mod ID: M6ASITE033700		Click to Show/Hide the Full List
mod site	chr1:77948602-77948603:-		[7]
Sequence	AAATGTACAAAATATCTATCACTACTGATAGGAGGTTAATA
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000294623.8; ENST00000488814.5; ENST00000492724.1; ENST00000492405.5; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_36983
mod ID: M6ASITE033701		Click to Show/Hide the Full List
mod site	chr1:77948616-77948617:-		[9]
Sequence	TTTTTTTTTTTTGAAAATGTACAAAATATCTATCACTACTG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000370768.6; ENST00000492405.5; ENST00000370767.5; ENST00000294623.8; ENST00000488814.5; ENST00000492724.1
External Link	RMBase: m6A_site_36984
mod ID: M6ASITE033702		Click to Show/Hide the Full List
mod site	chr1:77948692-77948693:-		[7]
Sequence	TGTTAAATATATGGATGCAGACGACTTGATGAAGATCTTAA
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000488814.5; ENST00000492405.5; ENST00000370767.5; ENST00000492724.1; ENST00000294623.8; ENST00000370768.6
External Link	RMBase: m6A_site_36985
mod ID: M6ASITE033703		Click to Show/Hide the Full List
mod site	chr1:77948717-77948718:-		[6]
Sequence	TCATTGTGTGGGGGAAAAAAACCTTTGTTAAATATATGGAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000488814.5; ENST00000492724.1; ENST00000294623.8; ENST00000370767.5; ENST00000370768.6; ENST00000492405.5
External Link	RMBase: m6A_site_36986
mod ID: M6ASITE033711		Click to Show/Hide the Full List
mod site	chr1:77948754-77948755:-		[6]
Sequence	GGGCCAATAATAAGAAGTGGACAATACAGTATTTGCTTCAT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; MT4; Huh7; AML
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5; ENST00000492724.1; ENST00000488814.5; ENST00000492405.5
External Link	RMBase: m6A_site_36987
mod ID: M6ASITE033722		Click to Show/Hide the Full List
mod site	chr1:77949175-77949176:-		[7]
Sequence	ACAAGTCCCCAGGGAATGCCACAGCATCCTCCAGCACCTCA
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000492724.1; ENST00000488814.5; ENST00000294623.8; ENST00000487684.1; ENST00000492405.5; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_36988
mod ID: M6ASITE033733		Click to Show/Hide the Full List
mod site	chr1:77949220-77949221:-		[9]
Sequence	GCCTGGGCTGAGTATTATAGACAACAAGCAGCCTATTATGC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000370768.6; ENST00000492724.1; ENST00000492405.5; ENST00000488814.5; ENST00000487684.1; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_36989
mod ID: M6ASITE033744		Click to Show/Hide the Full List
mod site	chr1:77955265-77955266:-		[9]
Sequence	CAAGGCTTGGGAAGAGTACTACAAGAAAATGGGTATGTTTT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000294623.8; ENST00000492405.5; ENST00000487684.1; ENST00000470287.1; ENST00000370767.5; ENST00000492724.1; ENST00000370768.6
External Link	RMBase: m6A_site_36990
mod ID: M6ASITE033755		Click to Show/Hide the Full List
mod site	chr1:77955300-77955301:-		[9]
Sequence	CAGAATCCAGCCCCAGCTGGACAGGTTGATTATACCAAGGC
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000470287.1; ENST00000370768.6; ENST00000294623.8; ENST00000492724.1; ENST00000370767.5; ENST00000487684.1
External Link	RMBase: m6A_site_36991
mod ID: M6ASITE033766		Click to Show/Hide the Full List
mod site	chr1:77956575-77956576:-		[6]
Sequence	ACTACAACTCAAACTAATGGACAAGGTAACTACAGAACTTA
Motif Score	3.643047619
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000470287.1; ENST00000370767.5
External Link	RMBase: m6A_site_36992
mod ID: M6ASITE033777		Click to Show/Hide the Full List
mod site	chr1:77956583-77956584:-		[6]
Sequence	GTGCACCAACTACAACTCAAACTAATGGACAAGGTAACTAC
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370767.5; ENST00000294623.8; ENST00000370768.6; ENST00000470287.1
External Link	RMBase: m6A_site_36993
mod ID: M6ASITE033788		Click to Show/Hide the Full List
mod site	chr1:77960214-77960215:-		[9]
Sequence	GGATGGGGAAATGCATATCCACACTGGCAGCAGCAGGCTCC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000370767.5; ENST00000470287.1; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: m6A_site_36994
mod ID: M6ASITE033799		Click to Show/Hide the Full List
mod site	chr1:77960363-77960364:-		[6]
Sequence	CCTGCACCTTATAATCCTGGACCACCAGGCCCGGCTCCTCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000470287.1; ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_36995
mod ID: M6ASITE033810		Click to Show/Hide the Full List
mod site	chr1:77960388-77960389:-		[9]
Sequence	TGGAACTCCAATGGGACCATACAACCCTGCACCTTATAATC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000470287.1; ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_36996
mod ID: M6ASITE033821		Click to Show/Hide the Full List
mod site	chr1:77960393-77960394:-		[6]
Sequence	GGGCCTGGAACTCCAATGGGACCATACAACCCTGCACCTTA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000470287.1; ENST00000370767.5
External Link	RMBase: m6A_site_36997
mod ID: M6ASITE033832		Click to Show/Hide the Full List
mod site	chr1:77960404-77960405:-		[6]
Sequence	CTGGGCCTCCAGGGCCTGGAACTCCAATGGGACCATACAAC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000294623.8; ENST00000470287.1
External Link	RMBase: m6A_site_36998
mod ID: M6ASITE033843		Click to Show/Hide the Full List
mod site	chr1:77960429-77960430:-		[6]
Sequence	GGTGTCCCAGGCCCCCATGGACCTCCTGGGCCTCCAGGGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000294623.8; ENST00000470287.1; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_36999
mod ID: M6ASITE033850		Click to Show/Hide the Full List
mod site	chr1:77960465-77960466:-		[7]
Sequence	AATCCTTTAGGGCCACCTGTACCCCATGGGCCCCATGGTGT
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000470287.1; ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_37000
mod ID: M6ASITE033851		Click to Show/Hide the Full List
mod site	chr1:77960764-77960765:-		[6]
Sequence	GGAACTACTGCTGTCCGCAAACAAGCTAAAGGAAATTTAAT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000470287.1; ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37001
mod ID: M6ASITE033852		Click to Show/Hide the Full List
mod site	chr1:77960781-77960782:-		[6]
Sequence	GAATGATAAAAGGAAAGGGAACTACTGCTGTCCGCAAACAA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000470287.1; ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_37002
mod ID: M6ASITE033853		Click to Show/Hide the Full List
mod site	chr1:77962282-77962283:-		[7]
Sequence	TGGGTGCTTCCCACTCCTACACATAATATACAGAGACAGAC
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37003
mod ID: M6ASITE033854		Click to Show/Hide the Full List
mod site	chr1:77962803-77962804:-		[6]
Sequence	TGGCACTCCACAACAGATAGACTATGCTCGGCAACTCATAG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000370768.6; ENST00000370767.5; ENST00000294623.8
External Link	RMBase: m6A_site_37004
mod ID: M6ASITE033855		Click to Show/Hide the Full List
mod site	chr1:77962831-77962832:-		[9]
Sequence	ATCCTAATATGAAGTTATTTACAATTCGTGGCACTCCACAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37005
mod ID: M6ASITE033856		Click to Show/Hide the Full List
mod site	chr1:77962880-77962881:-		[6]
Sequence	CAGTCTGGTGCAAGAATAGAACTTCAGAGAAATCCTCCACC
Motif Score	3.373380952
Cell/Tissue List	HeLa; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: m6A_site_37006
mod ID: M6ASITE033857		Click to Show/Hide the Full List
mod site	chr1:77962921-77962922:-		[6]
Sequence	TTTTGATTTTAGGAGGTGAAACCATAAAAAGCATAAGCCAG
Motif Score	2.185083333
Cell/Tissue List	HeLa; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: m6A_site_37007
mod ID: M6ASITE033858		Click to Show/Hide the Full List
mod site	chr1:77963594-77963595:-		[6]
Sequence	TTATTGTGCCAACTGGGAAAACTGGATTAATAATAGGAAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37008
mod ID: M6ASITE033859		Click to Show/Hide the Full List
mod site	chr1:77963631-77963632:-		[6]
Sequence	AACATGGGACCACCTGGTGGACTACAGGAATTTAATTTTAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37009
mod ID: M6ASITE033860		Click to Show/Hide the Full List
mod site	chr1:77963643-77963644:-		[6]
Sequence	CAAGGCAACTGGAACATGGGACCACCTGGTGGACTACAGGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_37010
mod ID: M6ASITE033861		Click to Show/Hide the Full List
mod site	chr1:77963650-77963651:-		[6]
Sequence	TAGAGGTCAAGGCAACTGGAACATGGGACCACCTGGTGGAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37011
mod ID: M6ASITE033862		Click to Show/Hide the Full List
mod site	chr1:77963691-77963692:-		[6]
Sequence	GGTAATCCTGGTGGACCTGGACCTGGTGGTCGAGGAAGAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37012
mod ID: M6ASITE033863		Click to Show/Hide the Full List
mod site	chr1:77963697-77963698:-		[6]
Sequence	TAGGCTGGTAATCCTGGTGGACCTGGACCTGGTGGTCGAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_37013
mod ID: M6ASITE033864		Click to Show/Hide the Full List
mod site	chr1:77964080-77964081:-		[6]
Sequence	TGCTGCAGAAATTATTACAGACCTTCTTCGAAGTGTTCAGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37014
mod ID: M6ASITE033865		Click to Show/Hide the Full List
mod site	chr1:77964113-77964114:-		[6]
Sequence	ACAAATAACAGGACCTCCAGACCGATGTCAACATGCTGCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37015
mod ID: M6ASITE033866		Click to Show/Hide the Full List
mod site	chr1:77964121-77964122:-		[6]
Sequence	AGGATAGCACAAATAACAGGACCTCCAGACCGATGTCAACA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: m6A_site_37016
mod ID: M6ASITE033867		Click to Show/Hide the Full List
mod site	chr1:77964153-77964154:-		[6]
Sequence	TTTGTTTTGAAGATGATGGGACAACACCCGAAAGGATAGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37017
mod ID: M6ASITE033868		Click to Show/Hide the Full List
mod site	chr1:77964290-77964291:-		[9]
Sequence	GGAGAGATGATCAAAAAAATACAAAATGATGCTGGTGTTCG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000370767.5
External Link	RMBase: m6A_site_37018
mod ID: M6ASITE033869		Click to Show/Hide the Full List
mod site	chr1:77964885-77964886:-		[6]
Sequence	ACCTCTTAGGATTACAGGAGACCCATATAAAGTTCAAGTAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; hNPCs; MT4; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37019
mod ID: M6ASITE033870		Click to Show/Hide the Full List
mod site	chr1:77964892-77964893:-		[8]
Sequence	CTGACAAACCTCTTAGGATTACAGGAGACCCATATAAAGTT
Motif Score	2.07285119
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000294623.8; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37020
mod ID: M6ASITE033871		Click to Show/Hide the Full List
mod site	chr1:77964905-77964906:-		[6]
Sequence	CAGAACACTGGTGCTGACAAACCTCTTAGGATTACAGGAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000370767.5; ENST00000294623.8
External Link	RMBase: m6A_site_37021
mod ID: M6ASITE033872		Click to Show/Hide the Full List
mod site	chr1:77964921-77964922:-		[6]
Sequence	GATTCAAGACGGGCCGCAGAACACTGGTGCTGACAAACCTC
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T; MT4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000370767.5; ENST00000294623.8
External Link	RMBase: m6A_site_37022
mod ID: M6ASITE033873		Click to Show/Hide the Full List
mod site	chr1:77965077-77965078:-		[6]
Sequence	AAAGGGGGAGAAACTATTAAACAGCTTCAGGTATTGTTATT
Motif Score	2.20572619
Cell/Tissue List	HeLa; MT4; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000370767.5; ENST00000421641.1; ENST00000294623.8
External Link	RMBase: m6A_site_37023
mod ID: M6ASITE033874		Click to Show/Hide the Full List
mod site	chr1:77965085-77965086:-		[6]
Sequence	TCATTGGAAAAGGGGGAGAAACTATTAAACAGCTTCAGGTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000421641.1; ENST00000370767.5; ENST00000294623.8; ENST00000370768.6
External Link	RMBase: m6A_site_37024
mod ID: M6ASITE033875		Click to Show/Hide the Full List
mod site	chr1:77965158-77965159:-		[10]
Sequence	GGCTTCCATCATGGCGATGGACCGGGAAATGCAGTTCAAGA
Motif Score	3.622404762
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000294623.8; ENST00000421641.1; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37025
mod ID: M6ASITE033876		Click to Show/Hide the Full List
mod site	chr1:77965188-77965189:-		[10]
Sequence	CAGATTGTTGAAAAAGGAAGACCAGCTCCTGGCTTCCATCA
Motif Score	2.876744048
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000370767.5; ENST00000421641.1
External Link	RMBase: m6A_site_37026
mod ID: M6ASITE033877		Click to Show/Hide the Full List
mod site	chr1:77965210-77965211:-		[10]
Sequence	GTCAGCAAAACGGTTACTGGACCAGATTGTTGAAAAAGGAA
Motif Score	3.622404762
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000370767.5; ENST00000421641.1
External Link	RMBase: m6A_site_37027
mod ID: M6ASITE033878		Click to Show/Hide the Full List
mod site	chr1:77966709-77966710:-		[6]
Sequence	GGTCCTGTATGTTAACTGGAACACCTGAATCTGTCCAGTAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000370767.5; ENST00000421641.1; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: m6A_site_37028
mod ID: M6ASITE033879		Click to Show/Hide the Full List
mod site	chr1:77966750-77966751:-		[8]
Sequence	CTGTTTGTTTTAAATTGTAGACAGTGGTGGCCTTCCAGAAA
Motif Score	2.897386905
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000370768.6; ENST00000370767.5; ENST00000294623.8; ENST00000421641.1
External Link	RMBase: m6A_site_37029
mod ID: M6ASITE033880		Click to Show/Hide the Full List
mod site	chr1:77966935-77966936:-		[6]
Sequence	GTAATTGGCAGAGGAGGTGAACAGATCTCACGCATACAACA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000421641.1; ENST00000294623.8
External Link	RMBase: m6A_site_37030
mod ID: M6ASITE033881		Click to Show/Hide the Full List
mod site	chr1:77967077-77967078:-		[9]
Sequence	ATCTGTAATGACAGAAGAATACAAAGTTCCAGATGGAATGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000294623.8; ENST00000421641.1; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37031
mod ID: M6ASITE033882		Click to Show/Hide the Full List
mod site	chr1:77967657-77967658:-		[6]
Sequence	ATTTTTTGATAGCTTTTGGAACACAGTTACCACCGATGCAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000421641.1; ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: m6A_site_37032
mod ID: M6ASITE033883		Click to Show/Hide the Full List
mod site	chr1:77969072-77969073:-		[10]
Sequence	TATGTGTAGATGGCTCTTGGACAAGTCCGAGCAGTACAACA
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000421641.1; ENST00000370767.5
External Link	RMBase: m6A_site_37033
mod ID: M6ASITE033884		Click to Show/Hide the Full List
mod site	chr1:77969940-77969941:-		[10]
Sequence	GGTTATGGGGGACAAAAAAGACCTTTAGAAGATGGAGGTAA
Motif Score	2.876744048
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000421641.1; ENST00000294623.8
External Link	RMBase: m6A_site_37034
mod ID: M6ASITE033885		Click to Show/Hide the Full List
mod site	chr1:77969949-77969950:-		[9]
Sequence	AATGACTATGGTTATGGGGGACAAAAAAGACCTTTAGAAGA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; HepG2; MT4; Huh7
Seq Type List	MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000421641.1; ENST00000294623.8
External Link	RMBase: m6A_site_37035
mod ID: M6ASITE033886		Click to Show/Hide the Full List
mod site	chr1:77969984-77969985:-		[8]
Sequence	AAATTGGAGGTGATGCAGGGACATCACTGAATTCAAATGAC
Motif Score	3.643047619
Cell/Tissue List	brain; liver; hESC-HEK293T; HepG2; MT4; Huh7
Seq Type List	m6A-REF-seq; MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000294623.8; ENST00000370768.6; ENST00000421641.1; ENST00000370767.5
External Link	RMBase: m6A_site_37036
mod ID: M6ASITE033887		Click to Show/Hide the Full List
mod site	chr1:77978988-77978989:-		[8]
Sequence	CAACCATGGCAGACTATTCAACAGTGCCTCCCCCCTCTTCT
Motif Score	2.173910714
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000370767.5; ENST00000421641.1; ENST00000370768.6; ENST00000294623.8
External Link	RMBase: m6A_site_37037
mod ID: M6ASITE033888		Click to Show/Hide the Full List
mod site	chr1:77978996-77978997:-		[11]
Sequence	TTATAGTGCAACCATGGCAGACTATTCAACAGTGCCTCCCC
Motif Score	3.319380952
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000370768.6; ENST00000370767.5; ENST00000421641.1; ENST00000294623.8
External Link	RMBase: m6A_site_37038
mod ID: M6ASITE033889		Click to Show/Hide the Full List
mod site	chr1:77979033-77979034:-		[11]
Sequence	AGCTGAGAGGAAGTCTCTGAACAGGCGGCAGCGGCTCTTAT
Motif Score	2.951386905
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000294623.8; ENST00000421641.1; ENST00000370767.5; ENST00000370768.6
External Link	RMBase: m6A_site_37039

N7-methylguanosine (m7G)

In total 4 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000045		Click to Show/Hide the Full List
mod site	chr1:77978936-77978937:-		[12]
Sequence	TGGCGGTGGTGGCGGCGGTGGTGGTGGAGGAGTTAACGACG
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000370768.6; ENST00000294623.8; ENST00000421641.1; ENST00000370767.5
External Link	RMBase: m7G_site_38
mod ID: m7GSITE000048		Click to Show/Hide the Full List
mod site	chr1:77978937-77978938:-		[12]
Sequence	GTGGCGGTGGTGGCGGCGGTGGTGGTGGAGGAGTTAACGAC
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000370767.5; ENST00000370768.6; ENST00000421641.1; ENST00000294623.8
External Link	RMBase: m7G_site_39
mod ID: m7GSITE000051		Click to Show/Hide the Full List
mod site	chr1:77978939-77978940:-		[12]
Sequence	TGGTGGCGGTGGTGGCGGCGGTGGTGGTGGAGGAGTTAACG
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000370768.6; ENST00000421641.1; ENST00000370767.5; ENST00000294623.8
External Link	RMBase: m7G_site_40
mod ID: m7GSITE000052		Click to Show/Hide the Full List
mod site	chr1:77978940-77978941:-		[12]
Sequence	CTGGTGGCGGTGGTGGCGGCGGTGGTGGTGGAGGAGTTAAC
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000421641.1; ENST00000370768.6; ENST00000370767.5; ENST00000294623.8
External Link	RMBase: m7G_site_41

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000101		Click to Show/Hide the Full List
mod site	chr1:77960468-77960469:-		[13]
Sequence	GTAAATCCTTTAGGGCCACCTGTACCCCATGGGCCCCATGG
Transcript ID List	ENST00000470287.1; ENST00000370768.6; ENST00000294623.8; ENST00000370767.5
External Link	RMBase: Pseudo_site_222

Ref 1	LCAT3, a novel m6A-regulated long non-coding RNA, plays an oncogenic role in lung cancer via binding with FUBP1 to activate c-MYC. J Hematol Oncol. 2021 Jul 17;14(1):112. doi: 10.1186/s13045-021-01123-0.
Ref 2	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 3	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 4	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 5	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 8	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 11	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 12	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.
Ref 13	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map