m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00242)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
EMP3
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
YTH domain-containing protein 1 (YTHDC1) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Epithelial membrane protein 3 (EMP3) blocks Akt-mTOR signaling activation and induces autophagy. EMP3 downregulates YTHDC1, which at least in part mediates the effects of EMP3 on breast cancer cells. EMP3 sensitizes breast cancer cells to the DNA-damaging drug Adriamycin. EMP3 downregulation can be responsible for breast cancer chemoresistance. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Responsed Drug | Doxil | Approved | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| mTOR signaling pathway | hsa04150 | |||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | DNA repair | |||
| In-vitro Model | BT-474 | Invasive breast carcinoma | Homo sapiens | CVCL_0179 |
| Hs 578T | Invasive breast carcinoma | Homo sapiens | CVCL_0332 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| SK-BR-3 | Breast adenocarcinoma | Homo sapiens | CVCL_0033 | |
Breast cancer [ICD-11: 2C60]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Epithelial membrane protein 3 (EMP3) blocks Akt-mTOR signaling activation and induces autophagy. EMP3 downregulates YTHDC1, which at least in part mediates the effects of EMP3 on breast cancer cells. EMP3 sensitizes breast cancer cells to the DNA-damaging drug Adriamycin. EMP3 downregulation can be responsible for breast cancer chemoresistance. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | YTH domain-containing protein 1 (YTHDC1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Doxil | Approved | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| mTOR signaling pathway | hsa04150 | |||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | DNA repair | |||
| In-vitro Model | BT-474 | Invasive breast carcinoma | Homo sapiens | CVCL_0179 |
| Hs 578T | Invasive breast carcinoma | Homo sapiens | CVCL_0332 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| SK-BR-3 | Breast adenocarcinoma | Homo sapiens | CVCL_0033 | |
Doxil
[Approved]
| In total 1 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | Epithelial membrane protein 3 (EMP3) blocks Akt-mTOR signaling activation and induces autophagy. EMP3 downregulates YTHDC1, which at least in part mediates the effects of EMP3 on breast cancer cells. EMP3 sensitizes breast cancer cells to the DNA-damaging drug Adriamycin. EMP3 downregulation can be responsible for breast cancer chemoresistance. | |||
| Target Regulator | YTH domain-containing protein 1 (YTHDC1) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| mTOR signaling pathway | hsa04150 | |||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | DNA repair | |||
| In-vitro Model | BT-474 | Invasive breast carcinoma | Homo sapiens | CVCL_0179 |
| Hs 578T | Invasive breast carcinoma | Homo sapiens | CVCL_0332 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| SK-BR-3 | Breast adenocarcinoma | Homo sapiens | CVCL_0033 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00242)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE009260 | Click to Show/Hide the Full List | ||
| mod site | chr19:48328956-48328957:+ | [2] | |
| Sequence | CATAGGGAAACCCTGTCTCTACAAAAATTTAAAAATTACCC | ||
| Transcript ID List | ENST00000596315.5; rmsk_5019139; ENST00000599255.5; ENST00000594198.1; ENST00000593437.1; ENST00000270221.11; ENST00000599704.5; ENST00000597279.5 | ||
| External Link | RMBase: RNA-editing_site_71687 | ||
| mod ID: A2ISITE009261 | Click to Show/Hide the Full List | ||
| mod site | chr19:48330377-48330378:+ | [3] | |
| Sequence | AGAAGCACCCGCGAGGGGGCAGCTTCGGATACTGCTTCGCC | ||
| Transcript ID List | ENST00000270221.11; ENST00000596315.5; ENST00000597279.5; ENST00000597057.1; ENST00000593437.1; ENST00000599255.5 | ||
| External Link | RMBase: RNA-editing_site_71688 | ||
N6-methyladenosine (m6A)
| In total 18 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE041767 | Click to Show/Hide the Full List | ||
| mod site | chr19:48325397-48325398:+ | [4] | |
| Sequence | CAAGAGAGAAGGAGGCCCAGACAGTGAGGGCAGGAGGGAGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; hESC-HEK293T; H1A; H1B; hNPCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | rmsk_5019132; ENST00000599704.5; ENST00000596315.5 | ||
| External Link | RMBase: m6A_site_446890 | ||
| mod ID: M6ASITE041768 | Click to Show/Hide the Full List | ||
| mod site | chr19:48325568-48325569:+ | [4] | |
| Sequence | CACGGAGGCCCGAGCGAGGGACAAGACTCCGACTCCAGCTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; hESC-HEK293T; H1B; fibroblasts; LCLs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000597529.1; ENST00000270221.11; ENST00000599255.5; ENST00000594198.1; ENST00000599704.5; ENST00000596315.5 | ||
| External Link | RMBase: m6A_site_446891 | ||
| mod ID: M6ASITE041769 | Click to Show/Hide the Full List | ||
| mod site | chr19:48325573-48325574:+ | [4] | |
| Sequence | AGGCCCGAGCGAGGGACAAGACTCCGACTCCAGCTCTGACT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; A549; H1B; fibroblasts; LCLs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000599704.5; ENST00000594198.1; ENST00000270221.11; ENST00000599255.5; ENST00000597529.1; ENST00000596315.5 | ||
| External Link | RMBase: m6A_site_446892 | ||
| mod ID: M6ASITE041770 | Click to Show/Hide the Full List | ||
| mod site | chr19:48325591-48325592:+ | [5] | |
| Sequence | AGACTCCGACTCCAGCTCTGACTTTTTTCGCGGCTCTCGGT | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000597279.5; ENST00000596315.5; ENST00000594198.1; ENST00000270221.11; ENST00000599704.5; ENST00000597529.1; ENST00000599255.5 | ||
| External Link | RMBase: m6A_site_446893 | ||
| mod ID: M6ASITE041771 | Click to Show/Hide the Full List | ||
| mod site | chr19:48326878-48326879:+ | [6] | |
| Sequence | GCTGGTGGTCTCAGCCCTTCACATCCTCATTCTTATACTGC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000593437.1; ENST00000599704.5; ENST00000597529.1; ENST00000596315.5; ENST00000270221.11; ENST00000594198.1; ENST00000597279.5; ENST00000599255.5 | ||
| External Link | RMBase: m6A_site_446894 | ||
| mod ID: M6ASITE041772 | Click to Show/Hide the Full List | ||
| mod site | chr19:48326917-48326918:+ | [6] | |
| Sequence | GCTTTTCGTGGCCACTTTGGACAAGGTAAGCCTACTTGGAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T; HepG2; peripheral-blood; endometrial; NB4; MM6 | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000596315.5; ENST00000599704.5; ENST00000270221.11; ENST00000594198.1; ENST00000597529.1; ENST00000593437.1; ENST00000597279.5; ENST00000599255.5 | ||
| External Link | RMBase: m6A_site_446895 | ||
| mod ID: M6ASITE041773 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327529-48327530:+ | [7] | |
| Sequence | GTCCATCCCAGTCCTGGTGGACTCTCCCTGGGAAAGAGTCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; peripheral-blood; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000599704.5; ENST00000270221.11; ENST00000593437.1; ENST00000597529.1; ENST00000599255.5; ENST00000594198.1; ENST00000597279.5; ENST00000596315.5 | ||
| External Link | RMBase: m6A_site_446896 | ||
| mod ID: M6ASITE041774 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327578-48327579:+ | [6] | |
| Sequence | CTGGTACGACTGCACGTGGAACAACGACACCAAAACATGGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T; peripheral-blood; NB4 | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000593437.1; ENST00000599704.5; ENST00000597279.5; ENST00000594198.1; ENST00000596315.5; ENST00000597529.1; ENST00000270221.11; ENST00000599255.5 | ||
| External Link | RMBase: m6A_site_446897 | ||
| mod ID: M6ASITE041775 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327592-48327593:+ | [6] | |
| Sequence | CGTGGAACAACGACACCAAAACATGGGCCTGCAGTAATGTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; peripheral-blood; NB4 | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000594198.1; ENST00000597279.5; ENST00000593437.1; ENST00000596315.5; ENST00000597529.1; ENST00000599255.5; ENST00000599704.5; ENST00000270221.11 | ||
| External Link | RMBase: m6A_site_446898 | ||
| mod ID: M6ASITE041776 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327644-48327645:+ | [8] | |
| Sequence | TGAGGGGTGAGGGCGGCGGGACTGGTCTTCAAAGGGGAAGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | peripheral-blood; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000597279.5; ENST00000599255.5; ENST00000596315.5; ENST00000593437.1; ENST00000594198.1; ENST00000597529.1; ENST00000270221.11; ENST00000599704.5 | ||
| External Link | RMBase: m6A_site_446899 | ||
| mod ID: M6ASITE041777 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327668-48327669:+ | [4] | |
| Sequence | GTCTTCAAAGGGGAAGGTAAACCCTTCGTGTCCTCATGGGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000599255.5; ENST00000599704.5; ENST00000270221.11; ENST00000597529.1; ENST00000593437.1; ENST00000596315.5; ENST00000597279.5; ENST00000594198.1 | ||
| External Link | RMBase: m6A_site_446900 | ||
| mod ID: M6ASITE041778 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327688-48327689:+ | [4] | |
| Sequence | ACCCTTCGTGTCCTCATGGGACTGAGAATTGGGAACCCTCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000594198.1; ENST00000597279.5; ENST00000599704.5; ENST00000597529.1; ENST00000599255.5; ENST00000593437.1; ENST00000596315.5; ENST00000270221.11 | ||
| External Link | RMBase: m6A_site_446901 | ||
| mod ID: M6ASITE041779 | Click to Show/Hide the Full List | ||
| mod site | chr19:48327702-48327703:+ | [4] | |
| Sequence | CATGGGACTGAGAATTGGGAACCCTCCCCCAACAAAGTTGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000597279.5; ENST00000599255.5; ENST00000596315.5; ENST00000597529.1; ENST00000593437.1; ENST00000599704.5; ENST00000270221.11; ENST00000594198.1 | ||
| External Link | RMBase: m6A_site_446902 | ||
| mod ID: M6ASITE041780 | Click to Show/Hide the Full List | ||
| mod site | chr19:48329304-48329305:+ | [9] | |
| Sequence | AGCAAGCAGGTGAAGCTGGAACTCTGGACCCACGGTGATGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Huh7; peripheral-blood | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000594198.1; ENST00000270221.11; ENST00000599255.5; ENST00000597279.5; ENST00000599704.5; ENST00000597057.1; ENST00000596315.5; ENST00000593437.1 | ||
| External Link | RMBase: m6A_site_446903 | ||
| mod ID: M6ASITE041781 | Click to Show/Hide the Full List | ||
| mod site | chr19:48329311-48329312:+ | [9] | |
| Sequence | AGGTGAAGCTGGAACTCTGGACCCACGGTGATGTCCCCCTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7; peripheral-blood | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000596315.5; ENST00000270221.11; ENST00000597057.1; ENST00000599704.5; ENST00000593437.1; ENST00000597279.5; ENST00000594198.1; ENST00000599255.5 | ||
| External Link | RMBase: m6A_site_446904 | ||
| mod ID: M6ASITE041782 | Click to Show/Hide the Full List | ||
| mod site | chr19:48329435-48329436:+ | [6] | |
| Sequence | CCTGTTCATGTTCCAGCTCTACACCATGCGACGAGGAGGTC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000597279.5; ENST00000597057.1; ENST00000599704.5; ENST00000594198.1; ENST00000596315.5; ENST00000270221.11; ENST00000599255.5; ENST00000593437.1 | ||
| External Link | RMBase: m6A_site_446905 | ||
| mod ID: M6ASITE041783 | Click to Show/Hide the Full List | ||
| mod site | chr19:48330444-48330445:+ | [6] | |
| Sequence | CCTGGTCAGCGGCATCATCTACATCCACCTACGGAAGCGGG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000593437.1; ENST00000597057.1; ENST00000597279.5; ENST00000270221.11; ENST00000596315.5; ENST00000599255.5 | ||
| External Link | RMBase: m6A_site_446906 | ||
| mod ID: M6ASITE041784 | Click to Show/Hide the Full List | ||
| mod site | chr19:48330540-48330541:+ | [10] | |
| Sequence | CGCGTCCTCCAAAAAATAAAACCTTAACCGCGGGCTCTGCC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000597279.5; ENST00000596315.5; ENST00000270221.11 | ||
| External Link | RMBase: m6A_site_446907 | ||
References