m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00242)

Target Name	Epithelial membrane protein 3 (EMP3)
Synonyms	EMP-3; Hematopoietic neural membrane protein 1; HNMP-1; Protein YMP; YMP Click to Show/Hide
Gene Name	EMP3
Chromosomal Location	19q13.33
Family	PMP-22/EMP/MP20 family
Function	Probably involved in cell proliferation and cell-cell interactions. Click to Show/Hide
Gene ID	2014
Uniprot ID	EMP3_HUMAN
HGNC ID	HGNC:3335
KEGG ID	hsa:2014

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

EMP3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

YTH domain-containing protein 1 (YTHDC1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Epithelial membrane protein 3 (EMP3) blocks Akt-mTOR signaling activation and induces autophagy. EMP3 downregulates YTHDC1, which at least in part mediates the effects of EMP3 on breast cancer cells. EMP3 sensitizes breast cancer cells to the DNA-damaging drug Adriamycin. EMP3 downregulation can be responsible for breast cancer chemoresistance.
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
Cell Process	DNA repair
In-vitro Model	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Epithelial membrane protein 3 (EMP3) blocks Akt-mTOR signaling activation and induces autophagy. EMP3 downregulates YTHDC1, which at least in part mediates the effects of EMP3 on breast cancer cells. EMP3 sensitizes breast cancer cells to the DNA-damaging drug Adriamycin. EMP3 downregulation can be responsible for breast cancer chemoresistance.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
Cell Process	DNA repair
In-vitro Model	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033

Doxil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Epithelial membrane protein 3 (EMP3) blocks Akt-mTOR signaling activation and induces autophagy. EMP3 downregulates YTHDC1, which at least in part mediates the effects of EMP3 on breast cancer cells. EMP3 sensitizes breast cancer cells to the DNA-damaging drug Adriamycin. EMP3 downregulation can be responsible for breast cancer chemoresistance.
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
	mTOR signaling pathway			hsa04150
	PI3K-Akt signaling pathway			hsa04151
Cell Process	DNA repair
In-vitro Model	BT-474	Invasive breast carcinoma	Homo sapiens	CVCL_0179
	Hs 578T	Invasive breast carcinoma	Homo sapiens	CVCL_0332
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	SK-BR-3	Breast adenocarcinoma	Homo sapiens	CVCL_0033

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00242)

Epithelial membrane protein 3 (EMP3)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009260		Click to Show/Hide the Full List
mod site	chr19:48328956-48328957:+		[2]
Sequence	CATAGGGAAACCCTGTCTCTACAAAAATTTAAAAATTACCC
Transcript ID List	ENST00000596315.5; rmsk_5019139; ENST00000599255.5; ENST00000594198.1; ENST00000593437.1; ENST00000270221.11; ENST00000599704.5; ENST00000597279.5
External Link	RMBase: RNA-editing_site_71687
mod ID: A2ISITE009261		Click to Show/Hide the Full List
mod site	chr19:48330377-48330378:+		[3]
Sequence	AGAAGCACCCGCGAGGGGGCAGCTTCGGATACTGCTTCGCC
Transcript ID List	ENST00000270221.11; ENST00000596315.5; ENST00000597279.5; ENST00000597057.1; ENST00000593437.1; ENST00000599255.5
External Link	RMBase: RNA-editing_site_71688

N6-methyladenosine (m6A)

In total 18 m6A sequence/site(s) in this target gene
mod ID: M6ASITE041767		Click to Show/Hide the Full List
mod site	chr19:48325397-48325398:+		[4]
Sequence	CAAGAGAGAAGGAGGCCCAGACAGTGAGGGCAGGAGGGAGA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; H1A; H1B; hNPCs; fibroblasts; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	rmsk_5019132; ENST00000599704.5; ENST00000596315.5
External Link	RMBase: m6A_site_446890
mod ID: M6ASITE041768		Click to Show/Hide the Full List
mod site	chr19:48325568-48325569:+		[4]
Sequence	CACGGAGGCCCGAGCGAGGGACAAGACTCCGACTCCAGCTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; H1B; fibroblasts; LCLs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000597529.1; ENST00000270221.11; ENST00000599255.5; ENST00000594198.1; ENST00000599704.5; ENST00000596315.5
External Link	RMBase: m6A_site_446891
mod ID: M6ASITE041769		Click to Show/Hide the Full List
mod site	chr19:48325573-48325574:+		[4]
Sequence	AGGCCCGAGCGAGGGACAAGACTCCGACTCCAGCTCTGACT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549; H1B; fibroblasts; LCLs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000599704.5; ENST00000594198.1; ENST00000270221.11; ENST00000599255.5; ENST00000597529.1; ENST00000596315.5
External Link	RMBase: m6A_site_446892
mod ID: M6ASITE041770		Click to Show/Hide the Full List
mod site	chr19:48325591-48325592:+		[5]
Sequence	AGACTCCGACTCCAGCTCTGACTTTTTTCGCGGCTCTCGGT
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000597279.5; ENST00000596315.5; ENST00000594198.1; ENST00000270221.11; ENST00000599704.5; ENST00000597529.1; ENST00000599255.5
External Link	RMBase: m6A_site_446893
mod ID: M6ASITE041771		Click to Show/Hide the Full List
mod site	chr19:48326878-48326879:+		[6]
Sequence	GCTGGTGGTCTCAGCCCTTCACATCCTCATTCTTATACTGC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000593437.1; ENST00000599704.5; ENST00000597529.1; ENST00000596315.5; ENST00000270221.11; ENST00000594198.1; ENST00000597279.5; ENST00000599255.5
External Link	RMBase: m6A_site_446894
mod ID: M6ASITE041772		Click to Show/Hide the Full List
mod site	chr19:48326917-48326918:+		[6]
Sequence	GCTTTTCGTGGCCACTTTGGACAAGGTAAGCCTACTTGGAG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; HepG2; peripheral-blood; endometrial; NB4; MM6
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000596315.5; ENST00000599704.5; ENST00000270221.11; ENST00000594198.1; ENST00000597529.1; ENST00000593437.1; ENST00000597279.5; ENST00000599255.5
External Link	RMBase: m6A_site_446895
mod ID: M6ASITE041773		Click to Show/Hide the Full List
mod site	chr19:48327529-48327530:+		[7]
Sequence	GTCCATCCCAGTCCTGGTGGACTCTCCCTGGGAAAGAGTCC
Motif Score	4.065041667
Cell/Tissue List	HepG2; peripheral-blood; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000599704.5; ENST00000270221.11; ENST00000593437.1; ENST00000597529.1; ENST00000599255.5; ENST00000594198.1; ENST00000597279.5; ENST00000596315.5
External Link	RMBase: m6A_site_446896
mod ID: M6ASITE041774		Click to Show/Hide the Full List
mod site	chr19:48327578-48327579:+		[6]
Sequence	CTGGTACGACTGCACGTGGAACAACGACACCAAAACATGGG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; peripheral-blood; NB4
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000593437.1; ENST00000599704.5; ENST00000597279.5; ENST00000594198.1; ENST00000596315.5; ENST00000597529.1; ENST00000270221.11; ENST00000599255.5
External Link	RMBase: m6A_site_446897
mod ID: M6ASITE041775		Click to Show/Hide the Full List
mod site	chr19:48327592-48327593:+		[6]
Sequence	CGTGGAACAACGACACCAAAACATGGGCCTGCAGTAATGTC
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; peripheral-blood; NB4
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000594198.1; ENST00000597279.5; ENST00000593437.1; ENST00000596315.5; ENST00000597529.1; ENST00000599255.5; ENST00000599704.5; ENST00000270221.11
External Link	RMBase: m6A_site_446898
mod ID: M6ASITE041776		Click to Show/Hide the Full List
mod site	chr19:48327644-48327645:+		[8]
Sequence	TGAGGGGTGAGGGCGGCGGGACTGGTCTTCAAAGGGGAAGG
Motif Score	4.065041667
Cell/Tissue List	peripheral-blood; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000597279.5; ENST00000599255.5; ENST00000596315.5; ENST00000593437.1; ENST00000594198.1; ENST00000597529.1; ENST00000270221.11; ENST00000599704.5
External Link	RMBase: m6A_site_446899
mod ID: M6ASITE041777		Click to Show/Hide the Full List
mod site	chr19:48327668-48327669:+		[4]
Sequence	GTCTTCAAAGGGGAAGGTAAACCCTTCGTGTCCTCATGGGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000599255.5; ENST00000599704.5; ENST00000270221.11; ENST00000597529.1; ENST00000593437.1; ENST00000596315.5; ENST00000597279.5; ENST00000594198.1
External Link	RMBase: m6A_site_446900
mod ID: M6ASITE041778		Click to Show/Hide the Full List
mod site	chr19:48327688-48327689:+		[4]
Sequence	ACCCTTCGTGTCCTCATGGGACTGAGAATTGGGAACCCTCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000594198.1; ENST00000597279.5; ENST00000599704.5; ENST00000597529.1; ENST00000599255.5; ENST00000593437.1; ENST00000596315.5; ENST00000270221.11
External Link	RMBase: m6A_site_446901
mod ID: M6ASITE041779		Click to Show/Hide the Full List
mod site	chr19:48327702-48327703:+		[4]
Sequence	CATGGGACTGAGAATTGGGAACCCTCCCCCAACAAAGTTGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000597279.5; ENST00000599255.5; ENST00000596315.5; ENST00000597529.1; ENST00000593437.1; ENST00000599704.5; ENST00000270221.11; ENST00000594198.1
External Link	RMBase: m6A_site_446902
mod ID: M6ASITE041780		Click to Show/Hide the Full List
mod site	chr19:48329304-48329305:+		[9]
Sequence	AGCAAGCAGGTGAAGCTGGAACTCTGGACCCACGGTGATGT
Motif Score	3.373380952
Cell/Tissue List	Huh7; peripheral-blood
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000594198.1; ENST00000270221.11; ENST00000599255.5; ENST00000597279.5; ENST00000599704.5; ENST00000597057.1; ENST00000596315.5; ENST00000593437.1
External Link	RMBase: m6A_site_446903
mod ID: M6ASITE041781		Click to Show/Hide the Full List
mod site	chr19:48329311-48329312:+		[9]
Sequence	AGGTGAAGCTGGAACTCTGGACCCACGGTGATGTCCCCCTC
Motif Score	3.622404762
Cell/Tissue List	Huh7; peripheral-blood
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000596315.5; ENST00000270221.11; ENST00000597057.1; ENST00000599704.5; ENST00000593437.1; ENST00000597279.5; ENST00000594198.1; ENST00000599255.5
External Link	RMBase: m6A_site_446904
mod ID: M6ASITE041782		Click to Show/Hide the Full List
mod site	chr19:48329435-48329436:+		[6]
Sequence	CCTGTTCATGTTCCAGCTCTACACCATGCGACGAGGAGGTC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000597279.5; ENST00000597057.1; ENST00000599704.5; ENST00000594198.1; ENST00000596315.5; ENST00000270221.11; ENST00000599255.5; ENST00000593437.1
External Link	RMBase: m6A_site_446905
mod ID: M6ASITE041783		Click to Show/Hide the Full List
mod site	chr19:48330444-48330445:+		[6]
Sequence	CCTGGTCAGCGGCATCATCTACATCCACCTACGGAAGCGGG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000593437.1; ENST00000597057.1; ENST00000597279.5; ENST00000270221.11; ENST00000596315.5; ENST00000599255.5
External Link	RMBase: m6A_site_446906
mod ID: M6ASITE041784		Click to Show/Hide the Full List
mod site	chr19:48330540-48330541:+		[10]
Sequence	CGCGTCCTCCAAAAAATAAAACCTTAACCGCGGGCTCTGCC
Motif Score	2.185083333
Cell/Tissue List	MM6
Seq Type List	m6A-seq
Transcript ID List	ENST00000597279.5; ENST00000596315.5; ENST00000270221.11
External Link	RMBase: m6A_site_446907

Ref 1	EMP3 negatively modulates breast cancer cell DNA replication, DNA damage repair, and stem-like properties. Cell Death Dis. 2021 Sep 12;12(9):844. doi: 10.1038/s41419-021-04140-6.
Ref 2	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 8	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.
Ref 9	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 10	FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell. 2017 Jan 9;31(1):127-141. doi: 10.1016/j.ccell.2016.11.017. Epub 2016 Dec 22.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map