General Information of the m6A Target Gene (ID: M6ATAR00236)
Target Name Peroxisomal bifunctional enzyme (EHHADH)
Synonyms
PBE; PBFE; L-bifunctional protein; LBP; Multifunctional enzyme 1; MFE1; ECHD
    Click to Show/Hide
Gene Name EHHADH
Chromosomal Location 3q27.2
Family enoyl-CoA hydratase/isomerase family
Function
Peroxisomal trifunctional enzyme possessing 2-enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase, and delta 3, delta 2-enoyl-CoA isomerase activities. Catalyzes two of the four reactions of the long chain fatty acids peroxisomal beta-oxidation pathway (By similarity). Can also use branched-chain fatty acids such as 2-methyl-2E-butenoyl-CoA as a substrate, which is hydrated into (2S,3S)-3-hydroxy-2-methylbutanoyl-CoA (By similarity). Optimal isomerase for 2,5 double bonds into 3,5 form isomerization in a range of enoyl-CoA species (Probable). Also able to isomerize both 3-cis and 3-trans double bonds into the 2-trans form in a range of enoyl-CoA species (By similarity). With HSD17B4, catalyzes the hydration of trans-2-enoyl-CoA and the dehydrogenation of 3-hydroxyacyl-CoA, but with opposite chiral specificity. Regulates the amount of medium-chain dicarboxylic fatty acids which are essential regulators of all fatty acid oxidation pathways (By similarity). Also involved in the degradation of long-chain dicarboxylic acids through peroxisomal beta-oxidation.
    Click to Show/Hide
Gene ID 1962
Uniprot ID
ECHP_HUMAN
HGNC ID
HGNC:3247
KEGG ID
hsa:1962
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
EHHADH can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
GSE167075
Regulation
logFC: -7.43E-01
p-value: 3.92E-35
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between EHHADH and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 7.66E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Dgat2, Peroxisomal bifunctional enzyme (EHHADH), Fasn, Foxo, Pgc1a and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Target Regulation Up regulation
Responsed Disease Type 2 diabetes mellitus ICD-11: 5A11
Pathway Response Insulin resistance hsa04931
Cell Process Lipid metabolism
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3 fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3 fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3 fl/fl) were used for experiments.
Type 2 diabetes mellitus [ICD-11: 5A11]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Dgat2, Peroxisomal bifunctional enzyme (EHHADH), Fasn, Foxo, Pgc1a and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Responsed Disease Type 2 diabetes mellitus [ICD-11: 5A11]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response Insulin resistance hsa04931
Cell Process Lipid metabolism
In-vitro Model Hep-G2 Hepatoblastoma Homo sapiens CVCL_0027
In-vivo Model Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3 fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3 fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3 fl/fl) were used for experiments.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00236)
Peroxisomal bifunctional enzyme (EHHADH)
Adenosine-to-Inosine editing (A-to-I)
In total 11 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000207 Click to Show/Hide the Full List
mod site chr3:185198226-185198227:- [2]
Sequence GACTCCATCTCAAAAAATAAACAAATAAATAAATAATAAAA
Transcript ID List ENST00000456310.5; ENST00000231887.8; rmsk_1191219
External Link RMBase: RNA-editing_site_101629
mod ID: A2ISITE000209 Click to Show/Hide the Full List
mod site chr3:185224245-185224246:- [3]
Sequence CGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTGC
Transcript ID List ENST00000483104.5; ENST00000456310.5; ENST00000231887.8; ENST00000475987.1
External Link RMBase: RNA-editing_site_101630
mod ID: A2ISITE000210 Click to Show/Hide the Full List
mod site chr3:185224281-185224282:- [3]
Sequence GTCTCAAACCGCCGACCTCAAGTGAGCCACCCGCCTCGGCC
Transcript ID List ENST00000483104.5; ENST00000475987.1; ENST00000231887.8; ENST00000456310.5
External Link RMBase: RNA-editing_site_101631
mod ID: A2ISITE000211 Click to Show/Hide the Full List
mod site chr3:185224282-185224283:- [3]
Sequence GGTCTCAAACCGCCGACCTCAAGTGAGCCACCCGCCTCGGC
Transcript ID List ENST00000456310.5; ENST00000483104.5; ENST00000475987.1; ENST00000231887.8
External Link RMBase: RNA-editing_site_101632
mod ID: A2ISITE000212 Click to Show/Hide the Full List
mod site chr3:185224326-185224327:- [3]
Sequence TTGTATTTTTAGTAGAGACAAGGTTTCACCATGTTGACCAG
Transcript ID List ENST00000456310.5; ENST00000475987.1; ENST00000231887.8; ENST00000483104.5
External Link RMBase: RNA-editing_site_101633
mod ID: A2ISITE000213 Click to Show/Hide the Full List
mod site chr3:185224327-185224328:- [3]
Sequence TTTGTATTTTTAGTAGAGACAAGGTTTCACCATGTTGACCA
Transcript ID List ENST00000483104.5; ENST00000456310.5; ENST00000475987.1; ENST00000231887.8
External Link RMBase: RNA-editing_site_101634
mod ID: A2ISITE000214 Click to Show/Hide the Full List
mod site chr3:185224333-185224334:- [3]
Sequence TAATTTTTTGTATTTTTAGTAGAGACAAGGTTTCACCATGT
Transcript ID List ENST00000456310.5; ENST00000483104.5; ENST00000231887.8; ENST00000475987.1
External Link RMBase: RNA-editing_site_101635
mod ID: A2ISITE000215 Click to Show/Hide the Full List
mod site chr3:185224342-185224343:- [3]
Sequence ACACCCGGCTAATTTTTTGTATTTTTAGTAGAGACAAGGTT
Transcript ID List ENST00000475987.1; ENST00000456310.5; ENST00000483104.5; ENST00000231887.8
External Link RMBase: RNA-editing_site_101636
mod ID: A2ISITE000216 Click to Show/Hide the Full List
mod site chr3:185224388-185224389:- [3]
Sequence CCTGCTTCAGCCTCTCCAGTAGCTGGGATTACAGGCACGTG
Transcript ID List ENST00000475987.1; ENST00000231887.8; ENST00000483104.5; ENST00000456310.5
External Link RMBase: RNA-editing_site_101637
mod ID: A2ISITE000217 Click to Show/Hide the Full List
mod site chr3:185224417-185224418:- [3]
Sequence ACCTCCACCTCCCGGGTTCAAGTGATTCTCCTGCTTCAGCC
Transcript ID List ENST00000456310.5; ENST00000231887.8; ENST00000483104.5; ENST00000475987.1
External Link RMBase: RNA-editing_site_101638
mod ID: A2ISITE000218 Click to Show/Hide the Full List
mod site chr3:185224448-185224449:- [3]
Sequence GAGTACAGTGGCACGATCTCAGCTCACCACAACCTCCACCT
Transcript ID List ENST00000483104.5; ENST00000475987.1; ENST00000456310.5; ENST00000231887.8
External Link RMBase: RNA-editing_site_101639
N6-methyladenosine (m6A)
In total 43 m6A sequence/site(s) in this target gene
mod ID: M6ASITE063844 Click to Show/Hide the Full List
mod site chr3:185190857-185190858:- [4]
Sequence TGTGGTGTAAATGAACTTTCACAATATTTTCACCTGTGAAC
Motif Score 2.047297619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000231887.8
External Link RMBase: m6A_site_621404
mod ID: M6ASITE063845 Click to Show/Hide the Full List
mod site chr3:185191160-185191161:- [4]
Sequence ATTTGAGACCAGCCTGGGCAACATAGCAAAACCCTGTCTCT
Motif Score 2.173910714
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List rmsk_1191202; ENST00000231887.8
External Link RMBase: m6A_site_621405
mod ID: M6ASITE063846 Click to Show/Hide the Full List
mod site chr3:185191238-185191239:- [4]
Sequence AGGGCCAGGCACAGTGGCTCACACCTGTAATCCCAGCACTT
Motif Score 2.047297619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List rmsk_1191202; ENST00000231887.8
External Link RMBase: m6A_site_621406
mod ID: M6ASITE063847 Click to Show/Hide the Full List
mod site chr3:185192201-185192202:- [4]
Sequence AGTCTTCCAGATTATGCCTCACATGCTAGCATCAGGTAATG
Motif Score 2.047297619
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621407
mod ID: M6ASITE063848 Click to Show/Hide the Full List
mod site chr3:185192377-185192378:- [4]
Sequence CTTCCACAGTTGGGTTGCCCACAGTTCTAGAGAAATTGCAG
Motif Score 2.053113095
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621408
mod ID: M6ASITE063849 Click to Show/Hide the Full List
mod site chr3:185192392-185192393:- [4]
Sequence GGCCCATGTTCTATGCTTCCACAGTTGGGTTGCCCACAGTT
Motif Score 2.053113095
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621409
mod ID: M6ASITE063850 Click to Show/Hide the Full List
mod site chr3:185192755-185192756:- [5]
Sequence GACCTACATTGCTTCCAGGAACTCCTGCCCGAAAAAGGGGT
Motif Score 3.373380952
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621410
mod ID: M6ASITE063851 Click to Show/Hide the Full List
mod site chr3:185192774-185192775:- [5]
Sequence AAGGGGCAAGGTCTTACTGGACCTACATTGCTTCCAGGAAC
Motif Score 3.622404762
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621411
mod ID: M6ASITE063852 Click to Show/Hide the Full List
mod site chr3:185192846-185192847:- [5]
Sequence GAGTTTGGTTTTAAAATGGGACCTTTTAGAGTGTCTGATCT
Motif Score 3.622404762
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621412
mod ID: M6ASITE063853 Click to Show/Hide the Full List
mod site chr3:185192894-185192895:- [5]
Sequence TTGTTAGAAGAAGGCAGCAAACCAGAGGAGGTAGATCAGGT
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621413
mod ID: M6ASITE063854 Click to Show/Hide the Full List
mod site chr3:185193015-185193016:- [5]
Sequence TACCATTGCCACTGTTATGAACTTATCAAAAAAGATTAAAA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; U2OS; A549; GM12878; Huh7; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621414
mod ID: M6ASITE063855 Click to Show/Hide the Full List
mod site chr3:185193194-185193195:- [5]
Sequence GAACTCTCAGCTGTGTGCAAACCAGAAGCATTTTTGTGCAC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621415
mod ID: M6ASITE063856 Click to Show/Hide the Full List
mod site chr3:185193212-185193213:- [5]
Sequence AAGAAGCAGGTCTTTGCTGAACTCTCAGCTGTGTGCAAACC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621416
mod ID: M6ASITE063857 Click to Show/Hide the Full List
mod site chr3:185193311-185193312:- [5]
Sequence CACCCTTGGTCAGGACCAAAACCCAGGTTAACTTCATCTGT
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621417
mod ID: M6ASITE063858 Click to Show/Hide the Full List
mod site chr3:185193317-185193318:- [5]
Sequence AGCGGCCACCCTTGGTCAGGACCAAAACCCAGGTTAACTTC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621418
mod ID: M6ASITE063859 Click to Show/Hide the Full List
mod site chr3:185193387-185193388:- [5]
Sequence AAACCAGCTAGCAACTGCAAACAAGATGATAACCTCTGTCT
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621419
mod ID: M6ASITE063860 Click to Show/Hide the Full List
mod site chr3:185193405-185193406:- [5]
Sequence TGCTGTAGACTCGGACAAAAACCAGCTAGCAACTGCAAACA
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621420
mod ID: M6ASITE063861 Click to Show/Hide the Full List
mod site chr3:185193411-185193412:- [5]
Sequence TGTGATTGCTGTAGACTCGGACAAAAACCAGCTAGCAACTG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621421
mod ID: M6ASITE063862 Click to Show/Hide the Full List
mod site chr3:185193417-185193418:- [5]
Sequence GATTCCTGTGATTGCTGTAGACTCGGACAAAAACCAGCTAG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621422
mod ID: M6ASITE063863 Click to Show/Hide the Full List
mod site chr3:185193478-185193479:- [5]
Sequence TTTTATCTGCAGGCTTGGGAACAATGGGCCGAGGCATTGTC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621423
mod ID: M6ASITE063864 Click to Show/Hide the Full List
mod site chr3:185204454-185204455:- [5]
Sequence CCTCCGGAGCATCGTGGAAAACAGCATCAGCGCGGCCTGTC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5
External Link RMBase: m6A_site_621424
mod ID: M6ASITE063865 Click to Show/Hide the Full List
mod site chr3:185204726-185204727:- [6]
Sequence AGAATCCCGTAGACTCTGCAACAAGCCAATTCAGAGCTTGC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000483104.5; ENST00000456310.5; ENST00000231887.8
External Link RMBase: m6A_site_621425
mod ID: M6ASITE063866 Click to Show/Hide the Full List
mod site chr3:185245929-185245930:- [7]
Sequence TTGGGCAGGCTCAGAAGGAGACTACACATAAGAGGAGCTGC
Motif Score 3.319380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000447161.1; ENST00000231887.8; ENST00000456310.5; ENST00000475987.1
External Link RMBase: m6A_site_621426
mod ID: M6ASITE063867 Click to Show/Hide the Full List
mod site chr3:185245960-185245961:- [7]
Sequence GTATCTCATTCAGTAATCAGACAGGCCCTGCTTGGGCAGGC
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000475987.1; ENST00000231887.8; ENST00000447161.1; ENST00000456310.5
External Link RMBase: m6A_site_621427
mod ID: M6ASITE063868 Click to Show/Hide the Full List
mod site chr3:185246033-185246034:- [7]
Sequence AAGTTCCCAGATGAGGATGAACTACTAGAGAAAGATGAAGC
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5; ENST00000447161.1; ENST00000475987.1
External Link RMBase: m6A_site_621428
mod ID: M6ASITE063869 Click to Show/Hide the Full List
mod site chr3:185246110-185246111:- [7]
Sequence GATGTTCAAGAACCAGCTGAACCAGAGGATGACCTTGACAT
Motif Score 2.930744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000475987.1; ENST00000456310.5; ENST00000447161.1; ENST00000231887.8
External Link RMBase: m6A_site_621429
mod ID: M6ASITE063870 Click to Show/Hide the Full List
mod site chr3:185246119-185246120:- [7]
Sequence ATTGAAAGTGATGTTCAAGAACCAGCTGAACCAGAGGATGA
Motif Score 2.930744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000447161.1; ENST00000456310.5; ENST00000475987.1
External Link RMBase: m6A_site_621430
mod ID: M6ASITE063871 Click to Show/Hide the Full List
mod site chr3:185246193-185246194:- [7]
Sequence CAAAAGAAAAAGAAAAAAAAACAAAAAAGATATTTGATATT
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000447161.1; ENST00000231887.8; ENST00000456310.5; ENST00000475987.1
External Link RMBase: m6A_site_621431
mod ID: M6ASITE063872 Click to Show/Hide the Full List
mod site chr3:185246224-185246225:- [7]
Sequence TGATGATCTAGATGACTTGAACTTCTTTAATCAAAAGAAAA
Motif Score 3.373380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000475987.1; ENST00000456310.5; ENST00000231887.8; ENST00000447161.1
External Link RMBase: m6A_site_621432
mod ID: M6ASITE063873 Click to Show/Hide the Full List
mod site chr3:185246266-185246267:- [7]
Sequence TTTGGAAGCTGACAATGAGGACAGTAGGAAAAACGATGCTT
Motif Score 3.643047619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000475987.1; ENST00000231887.8; ENST00000456310.5; ENST00000447161.1
External Link RMBase: m6A_site_621433
mod ID: M6ASITE063874 Click to Show/Hide the Full List
mod site chr3:185246293-185246294:- [7]
Sequence GGAGCCAGAGCCAACTGAGGACAAAGATTTGGAAGCTGACA
Motif Score 3.643047619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000447161.1; ENST00000456310.5; ENST00000231887.8; ENST00000475987.1
External Link RMBase: m6A_site_621434
mod ID: M6ASITE063875 Click to Show/Hide the Full List
mod site chr3:185246323-185246324:- [7]
Sequence AGGAAACGCAGCCCTCAGAAACAAAAGTCTGGAGCCAGAGC
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000456310.5; ENST00000447161.1; ENST00000231887.8; ENST00000475987.1
External Link RMBase: m6A_site_621435
mod ID: M6ASITE063876 Click to Show/Hide the Full List
mod site chr3:185246345-185246346:- [7]
Sequence ATGAGGAAGGGGATACTCAAACAGGAAACGCAGCCCTCAGA
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000475987.1; ENST00000456310.5; ENST00000447161.1; ENST00000231887.8
External Link RMBase: m6A_site_621436
mod ID: M6ASITE063877 Click to Show/Hide the Full List
mod site chr3:185248466-185248467:- [5]
Sequence ACTACAGAAAGCTGTAATAGACCATACAATAAAAGCCATTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5; ENST00000465178.1; ENST00000475987.1; ENST00000440662.1
External Link RMBase: m6A_site_621437
mod ID: M6ASITE063878 Click to Show/Hide the Full List
mod site chr3:185248486-185248487:- [5]
Sequence CTCCGTGACATAAAAGAAGGACTACAGAAAGCTGTAATAGA
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000465178.1; ENST00000456310.5; ENST00000475987.1; ENST00000231887.8; ENST00000440662.1
External Link RMBase: m6A_site_621438
mod ID: M6ASITE063879 Click to Show/Hide the Full List
mod site chr3:185253846-185253847:- [5]
Sequence GTCGGTTTAAACCGAGAAGGACACTCAAGAGTTGAGCAACT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000456310.5; ENST00000475987.1; ENST00000440662.1; ENST00000465178.1
External Link RMBase: m6A_site_621439
mod ID: M6ASITE063880 Click to Show/Hide the Full List
mod site chr3:185253856-185253857:- [5]
Sequence ACTCTCCCCCGTCGGTTTAAACCGAGAAGGACACTCAAGAG
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000440662.1; ENST00000465178.1; ENST00000231887.8; ENST00000475987.1; ENST00000456310.5
External Link RMBase: m6A_site_621440
mod ID: M6ASITE063881 Click to Show/Hide the Full List
mod site chr3:185253917-185253918:- [5]
Sequence CGGTCGCCTCCAGCCCGGGGACCGTGCGGGCCTTAGCCGCC
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293A-TOA; iSLK; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000440662.1; ENST00000456310.5; ENST00000231887.8; ENST00000465178.1; ENST00000475987.1
External Link RMBase: m6A_site_621441
mod ID: M6ASITE063882 Click to Show/Hide the Full List
mod site chr3:185253969-185253970:- [8]
Sequence GGCGCTAATCCGCCTCCGAAACCCGCCGGTCAACGCGATCA
Motif Score 2.185083333
Cell/Tissue List iSLK; MSC
Seq Type List MeRIP-seq
Transcript ID List ENST00000440662.1; ENST00000456310.5; ENST00000475987.1; ENST00000465178.1; ENST00000231887.8
External Link RMBase: m6A_site_621442
mod ID: M6ASITE063883 Click to Show/Hide the Full List
mod site chr3:185254023-185254024:- [8]
Sequence TGCCCTCGGTGATAGAGGAAACATGGCCGAGTATACGCGGC
Motif Score 2.20572619
Cell/Tissue List iSLK; MSC
Seq Type List MeRIP-seq
Transcript ID List ENST00000231887.8; ENST00000465178.1; ENST00000475987.1; ENST00000440662.1; ENST00000456310.5
External Link RMBase: m6A_site_621443
mod ID: M6ASITE063884 Click to Show/Hide the Full List
mod site chr3:185280320-185280321:- [8]
Sequence TTTGCCTGATGTTACAGAAAACTTGTCACAGATTGAGTATT
Motif Score 2.627720238
Cell/Tissue List TREX
Seq Type List MeRIP-seq
Transcript ID List ENST00000465178.1
External Link RMBase: m6A_site_621444
mod ID: M6ASITE063885 Click to Show/Hide the Full List
mod site chr3:185281950-185281951:- [8]
Sequence GAATGACAGAACTGAAAGGAACTTTTAGAGGCAATCACTTA
Motif Score 3.373380952
Cell/Tissue List TREX
Seq Type List MeRIP-seq
Transcript ID List ENST00000465178.1
External Link RMBase: m6A_site_621445
mod ID: M6ASITE063886 Click to Show/Hide the Full List
mod site chr3:185281960-185281961:- [8]
Sequence AAATTTCGCAGAATGACAGAACTGAAAGGAACTTTTAGAGG
Motif Score 3.373380952
Cell/Tissue List TREX
Seq Type List MeRIP-seq
Transcript ID List ENST00000465178.1
External Link RMBase: m6A_site_621446