General Information of the m6A Target Gene (ID: M6ATAR00233)
Target Name Dual specificity protein phosphatase 6 (DUSP6)
Synonyms
Dual specificity protein phosphatase PYST1; Mitogen-activated protein kinase phosphatase 3; MAP kinase phosphatase 3; MKP-3; MKP3; PYST1
    Click to Show/Hide
Gene Name DUSP6
Chromosomal Location 12q21.33
Family protein-tyrosine phosphatase family; Non-receptor class dual specificity subfamily
Function
Inactivates MAP kinases. Has a specificity for the ERK family. Plays an important role in alleviating chronic postoperative pain. Necessary for the normal dephosphorylation of the long-lasting phosphorylated forms of spinal MAPK1/3 and MAP kinase p38 induced by peripheral surgery, which drives the resolution of acute postoperative allodynia (By similarity). Also important for dephosphorylation of MAPK1/3 in local wound tissue, which further contributes to resolution of acute pain (By similarity). Promotes cell differentiation by regulating MAPK1/MAPK3 activity and regulating the expression of AP1 transcription factors.
    Click to Show/Hide
Gene ID 1848
Uniprot ID
DUS6_HUMAN
HGNC ID
HGNC:3072
KEGG ID
hsa:1848
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
DUSP6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Wilms tumor 1-associating protein (WTAP) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by WTAP
Cell Line mouse embryonic stem cells Mus musculus
Treatment: WTAP-/- ESCs
Control: Wild type ESCs
GSE145309
Regulation
logFC: -6.99E-01
p-value: 7.61E-15
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A methyltransferase Wilms' tumor 1-associated protein facilitates cell proliferation and cisplatin resistance in NK/T cell lymphoma by regulating dual-specificity phosphatases 6 expression via m6A RNA methylation. WTAP enhanced Dual specificity protein phosphatase 6 (DUSP6) expression by increasing m6A levels of DUSP6 mRNA transcript, leading to oncogenic functions in NKTCL.
Target Regulation Up regulation
Responsed Disease Malignant haematopoietic neoplasm ICD-11: 2B33
Responsed Drug Cisplatin Approved
Cell Process Cell apoptosis
In-vitro Model Normal NK cells (CD3-negative lymphocytes)
SNK-6 Nasal type extranodal NK/T-cell lymphoma Homo sapiens CVCL_A673
YTS Lymphoblastic leukemia/lymphoma Homo sapiens CVCL_D324
Malignant haematopoietic neoplasm [ICD-11: 2B33]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A methyltransferase Wilms' tumor 1-associated protein facilitates cell proliferation and cisplatin resistance in NK/T cell lymphoma by regulating dual-specificity phosphatases 6 expression via m6A RNA methylation. WTAP enhanced Dual specificity protein phosphatase 6 (DUSP6) expression by increasing m6A levels of DUSP6 mRNA transcript, leading to oncogenic functions in NKTCL.
Responsed Disease Malignant haematopoietic neoplasm [ICD-11: 2B33]
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
Target Regulation Up regulation
Responsed Drug Cisplatin Approved
Cell Process Cell apoptosis
In-vitro Model Normal NK cells (CD3-negative lymphocytes)
SNK-6 Nasal type extranodal NK/T-cell lymphoma Homo sapiens CVCL_A673
YTS Lymphoblastic leukemia/lymphoma Homo sapiens CVCL_D324
Cisplatin [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary m6A methyltransferase Wilms' tumor 1-associated protein facilitates cell proliferation and cisplatin resistance in NK/T cell lymphoma by regulating dual-specificity phosphatases 6 expression via m6A RNA methylation. WTAP enhanced Dual specificity protein phosphatase 6 (DUSP6) expression by increasing m6A levels of DUSP6 mRNA transcript, leading to oncogenic functions in NKTCL.
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
Target Regulation Up regulation
Responsed Disease Malignant haematopoietic neoplasm ICD-11: 2B33
Cell Process Cell apoptosis
In-vitro Model Normal NK cells (CD3-negative lymphocytes)
SNK-6 Nasal type extranodal NK/T-cell lymphoma Homo sapiens CVCL_A673
YTS Lymphoblastic leukemia/lymphoma Homo sapiens CVCL_D324
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00233)
Dual specificity protein phosphatase 6 (DUSP6)
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000083 Click to Show/Hide the Full List
mod site chr12:89348122-89348123:-
Sequence TCGTGGTGTAAAGTTTAGAGCTGGAATTTATTATAAGAATG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000279488.8
External Link RMBase: m5C_site_10700
mod ID: M5CSITE000084 Click to Show/Hide the Full List
mod site chr12:89348318-89348319:-
Sequence CTGTGCTAAACAGTATATTACCTCTGTATAAAATTCTTCAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000279488.8
External Link RMBase: m5C_site_10701
N6-methyladenosine (m6A)
In total 44 m6A sequence/site(s) in this target gene
mod ID: M6ASITE014465 Click to Show/Hide the Full List
mod site chr12:89348329-89348330:- [2]
Sequence AAAACCTTCAGCTGTGCTAAACAGTATATTACCTCTGTATA
Motif Score 2.20572619
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000279488.8
External Link RMBase: m6A_site_201362
mod ID: M6ASITE014466 Click to Show/Hide the Full List
mod site chr12:89348346-89348347:- [3]
Sequence AAAAAAGAAAGAATAAAAAAACCTTCAGCTGTGCTAAACAG
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000279488.8
External Link RMBase: m6A_site_201363
mod ID: M6ASITE014467 Click to Show/Hide the Full List
mod site chr12:89348390-89348391:- [3]
Sequence AAGGGGATAATCTGGGAAAGACACCAAATCATGGGCTCACT
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201364
mod ID: M6ASITE014468 Click to Show/Hide the Full List
mod site chr12:89348524-89348525:- [4]
Sequence CGGACACTATTATCACTAAGACCTTGTTATGGCGAAGTCTT
Motif Score 2.876744048
Cell/Tissue List hNPCs; hESCs; fibroblasts; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201365
mod ID: M6ASITE014469 Click to Show/Hide the Full List
mod site chr12:89348541-89348542:- [5]
Sequence TTCTGATGACATCTTTACGGACACTATTATCACTAAGACCT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T; hNPCs; hESCs; fibroblasts; A549; Huh7; AML
Seq Type List MAZTER-seq; m6A-seq; m6A-CLIP/IP; MeRIP-seq; miCLIP
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201366
mod ID: M6ASITE014470 Click to Show/Hide the Full List
mod site chr12:89348553-89348554:- [5]
Sequence TGACTTTACCAATTCTGATGACATCTTTACGGACACTATTA
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201367
mod ID: M6ASITE014471 Click to Show/Hide the Full List
mod site chr12:89348629-89348630:- [5]
Sequence ACTTCTTAAAACAGAACAAAACAAAAAAAGAAAATTGTGCT
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T; hNPCs; hESCs; fibroblasts; Huh7
Seq Type List MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201368
mod ID: M6ASITE014472 Click to Show/Hide the Full List
mod site chr12:89348634-89348635:- [4]
Sequence ATGCCACTTCTTAAAACAGAACAAAACAAAAAAAGAAAATT
Motif Score 2.951386905
Cell/Tissue List hNPCs; hESCs; fibroblasts; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201369
mod ID: M6ASITE014473 Click to Show/Hide the Full List
mod site chr12:89348639-89348640:- [4]
Sequence GCAGTATGCCACTTCTTAAAACAGAACAAAACAAAAAAAGA
Motif Score 2.20572619
Cell/Tissue List fibroblasts; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201370
mod ID: M6ASITE014474 Click to Show/Hide the Full List
mod site chr12:89348857-89348858:- [6]
Sequence TATAATTGTCTTCAATGAAGACTAATTCAATTTTGCATATA
Motif Score 3.319380952
Cell/Tissue List HepG2; HeLa; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201371
mod ID: M6ASITE014475 Click to Show/Hide the Full List
mod site chr12:89348881-89348882:- [7]
Sequence TCCTTTTGCATCTGGAACTGACTATATAATTGTCTTCAATG
Motif Score 3.28175
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201372
mod ID: M6ASITE014476 Click to Show/Hide the Full List
mod site chr12:89348885-89348886:- [8]
Sequence TGTTTCCTTTTGCATCTGGAACTGACTATATAATTGTCTTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201373
mod ID: M6ASITE014477 Click to Show/Hide the Full List
mod site chr12:89348952-89348953:- [8]
Sequence TTCCAGGCGCATAGGGTAGAACCAAATGATAGGGTAGGAGC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201374
mod ID: M6ASITE014478 Click to Show/Hide the Full List
mod site chr12:89348974-89348975:- [8]
Sequence GCAGGGACTGGGATTCGAGGACTTCCAGGCGCATAGGGTAG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201375
mod ID: M6ASITE014479 Click to Show/Hide the Full List
mod site chr12:89348988-89348989:- [8]
Sequence TACAGCCTACCCATGCAGGGACTGGGATTCGAGGACTTCCA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201376
mod ID: M6ASITE014480 Click to Show/Hide the Full List
mod site chr12:89349054-89349055:- [6]
Sequence ATTCTCTTTGGAATAACAGGACATGCTGTATAGATACAGGC
Motif Score 3.643047619
Cell/Tissue List HepG2; HeLa; A549; hESC-HEK293T; H1B; H1A; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201377
mod ID: M6ASITE014481 Click to Show/Hide the Full List
mod site chr12:89349125-89349126:- [9]
Sequence ACACCAGCTGTCTGTACTAGACAAGGTTACCAAGTGCGGAA
Motif Score 2.897386905
Cell/Tissue List HeLa; A549; HepG2; hESCs; fibroblasts; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8; ENST00000547291.1
External Link RMBase: m6A_site_201378
mod ID: M6ASITE014482 Click to Show/Hide the Full List
mod site chr12:89349249-89349250:- [9]
Sequence CTCTGCAATCTACGTGAAAGACCCCACACCCCTCCTTGCTG
Motif Score 2.876744048
Cell/Tissue List HEK293T; HeLa; A549; HepG2; hNPCs; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000547291.1; ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201379
mod ID: M6ASITE014483 Click to Show/Hide the Full List
mod site chr12:89349272-89349273:- [9]
Sequence CCAGAATGTATACCAGGTGGACTCTCTGCAATCTACGTGAA
Motif Score 4.065041667
Cell/Tissue List HEK293T; HeLa; A549; HepG2; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A; AML
Seq Type List MeRIP-seq; m6A-seq; miCLIP
Transcript ID List ENST00000547291.1; ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201380
mod ID: M6ASITE014484 Click to Show/Hide the Full List
mod site chr12:89349355-89349356:- [6]
Sequence GACTTCGAGAGGACGCTGGGACTCAGCAGCCCATGTGACAA
Motif Score 4.065041667
Cell/Tissue List HepG2; HEK293T; HeLa; A549; H1B; H1A; hNPCs; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000547291.1; ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201381
mod ID: M6ASITE014485 Click to Show/Hide the Full List
mod site chr12:89349363-89349364:- [7]
Sequence AGCTGCTGGACTTCGAGAGGACGCTGGGACTCAGCAGCCCA
Motif Score 3.616982143
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000547291.1; ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201382
mod ID: M6ASITE014486 Click to Show/Hide the Full List
mod site chr12:89349374-89349375:- [6]
Sequence CTTCATGGGTCAGCTGCTGGACTTCGAGAGGACGCTGGGAC
Motif Score 4.065041667
Cell/Tissue List HepG2; HEK293T; HeLa; A549; H1B; H1A; hNPCs; hESCs; fibroblasts; CD8T; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000547291.1; ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201383
mod ID: M6ASITE014487 Click to Show/Hide the Full List
mod site chr12:89349437-89349438:- [5]
Sequence GTCGATGAACGATGCCTATGACATTGTCAAAATGAAAAAAT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T; A549
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000547291.1; ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201384
mod ID: M6ASITE014488 Click to Show/Hide the Full List
mod site chr12:89349449-89349450:- [7]
Sequence GAAGCTCAATCTGTCGATGAACGATGCCTATGACATTGTCA
Motif Score 2.925321429
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000308385.6; ENST00000547291.1; ENST00000279488.8
External Link RMBase: m6A_site_201385
mod ID: M6ASITE014489 Click to Show/Hide the Full List
mod site chr12:89349526-89349527:- [5]
Sequence AAGAACTGTGGTGTCTTGGTACATTGCTTGGCTGGCATTAG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000547291.1; ENST00000279488.8; ENST00000308385.6; ENST00000547140.1
External Link RMBase: m6A_site_201386
mod ID: M6ASITE014490 Click to Show/Hide the Full List
mod site chr12:89349542-89349543:- [6]
Sequence AGATGAAGCCCGGGGCAAGAACTGTGGTGTCTTGGTACATT
Motif Score 3.373380952
Cell/Tissue List HepG2; HeLa; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; CD4T; HEK293A-TOA; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000547140.1; ENST00000308385.6; ENST00000547291.1; ENST00000279488.8
External Link RMBase: m6A_site_201387
mod ID: M6ASITE014491 Click to Show/Hide the Full List
mod site chr12:89350625-89350626:- [6]
Sequence CTCGGATCACTGGAGCCAAAACCTGTCCCAGTTTTTCCCTG
Motif Score 2.185083333
Cell/Tissue List HepG2; HeLa; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8; ENST00000547291.1; ENST00000547140.1
External Link RMBase: m6A_site_201388
mod ID: M6ASITE014492 Click to Show/Hide the Full List
mod site chr12:89350721-89350722:- [5]
Sequence GGAGGAATTCGGCATCAAGTACATCTTGAACGTCACCCCCA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000547140.1; ENST00000308385.6; ENST00000279488.8; ENST00000547291.1
External Link RMBase: m6A_site_201389
mod ID: M6ASITE014493 Click to Show/Hide the Full List
mod site chr12:89350763-89350764:- [8]
Sequence CTACTTGGGCTGTGCCAAAGACTCCACCAACTTGGACGTGT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000547140.1; ENST00000279488.8; ENST00000547291.1; ENST00000308385.6
External Link RMBase: m6A_site_201390
mod ID: M6ASITE014494 Click to Show/Hide the Full List
mod site chr12:89350847-89350848:- [8]
Sequence AGACCCCAATAGTGCAACAGACTCGGATGGTAGTCCGCTGT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hESCs; fibroblasts; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000547140.1; ENST00000547291.1; ENST00000308385.6
External Link RMBase: m6A_site_201391
mod ID: M6ASITE014495 Click to Show/Hide the Full List
mod site chr12:89350851-89350852:- [2]
Sequence ACCGAGACCCCAATAGTGCAACAGACTCGGATGGTAGTCCG
Motif Score 2.173910714
Cell/Tissue List brain; kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000279488.8; ENST00000547140.1; ENST00000308385.6; ENST00000547291.1
External Link RMBase: m6A_site_201392
mod ID: M6ASITE014496 Click to Show/Hide the Full List
mod site chr12:89350865-89350866:- [8]
Sequence CGAGTCTGACCTTGACCGAGACCCCAATAGTGCAACAGACT
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hESCs; fibroblasts; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000547291.1; ENST00000308385.6; ENST00000279488.8; ENST00000547140.1
External Link RMBase: m6A_site_201393
mod ID: M6ASITE014497 Click to Show/Hide the Full List
mod site chr12:89350871-89350872:- [7]
Sequence GGACATCGAGTCTGACCTTGACCGAGACCCCAATAGTGCAA
Motif Score 2.839113095
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000547140.1; ENST00000308385.6; ENST00000547291.1; ENST00000279488.8
External Link RMBase: m6A_site_201394
mod ID: M6ASITE014498 Click to Show/Hide the Full List
mod site chr12:89350889-89350890:- [8]
Sequence CAGCTCTGACTCTTCCTCGGACATCGAGTCTGACCTTGACC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hESCs; fibroblasts; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000547140.1; ENST00000547291.1; ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201395
mod ID: M6ASITE014499 Click to Show/Hide the Full List
mod site chr12:89350980-89350981:- [8]
Sequence AGTTCTCCCTGCATTGCGAGACCAATCTAGACGGCTCGTGT
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; H1B; A549; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000547140.1; ENST00000547291.1; ENST00000308385.6; ENST00000279488.8
External Link RMBase: m6A_site_201396
mod ID: M6ASITE014500 Click to Show/Hide the Full List
mod site chr12:89351072-89351073:- [10]
Sequence GGTTCTTACAAGCTGTGAAAACTACTACGGCTTCTCAGGTT
Motif Score 2.627720238
Cell/Tissue List NB4
Seq Type List m6A-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8; ENST00000547140.1; ENST00000547291.1
External Link RMBase: m6A_site_201397
mod ID: M6ASITE014501 Click to Show/Hide the Full List
mod site chr12:89351788-89351789:- [11]
Sequence CACGCGCGGCGAGGACCGGGACCGCTTCACCCGGCGCTGTG
Motif Score 3.622404762
Cell/Tissue List HepG2; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6; ENST00000548755.1
External Link RMBase: m6A_site_201398
mod ID: M6ASITE014502 Click to Show/Hide the Full List
mod site chr12:89351794-89351795:- [11]
Sequence GCTCTTCACGCGCGGCGAGGACCGGGACCGCTTCACCCGGC
Motif Score 3.622404762
Cell/Tissue List HepG2; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000308385.6; ENST00000548755.1
External Link RMBase: m6A_site_201399
mod ID: M6ASITE014503 Click to Show/Hide the Full List
mod site chr12:89351926-89351927:- [11]
Sequence CGAGCGGCTGCTGCTGATGGACTGCCGGCCGCAGGAGCTAT
Motif Score 4.065041667
Cell/Tissue List HepG2; H1A; H1B; hESCs; HEK293T; fibroblasts; A549; MM6; CD4T; peripheral-blood; GSC-11; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000279488.8; ENST00000548755.1
External Link RMBase: m6A_site_201400
mod ID: M6ASITE014504 Click to Show/Hide the Full List
mod site chr12:89352021-89352022:- [12]
Sequence CCCATGATAGATACGCTCAGACCCGTGCCCTTCGCGTCGGA
Motif Score 2.876744048
Cell/Tissue List peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000548755.1; ENST00000279488.8; ENST00000308385.6
External Link RMBase: m6A_site_201401
mod ID: M6ASITE014505 Click to Show/Hide the Full List
mod site chr12:89352213-89352214:- [9]
Sequence TGCAGCTGGGTGCAGAGAGAACCTCCGGCTTTACTTCTGTC
Motif Score 2.930744048
Cell/Tissue List A549; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000279488.8; ENST00000548755.1; ENST00000308385.6
External Link RMBase: m6A_site_201403
mod ID: M6ASITE014506 Click to Show/Hide the Full List
mod site chr12:89352286-89352287:- [6]
Sequence TTCACTGGGGAGGAACAAAAACTATCTGGGCAGCTTCATTG
Motif Score 2.627720238
Cell/Tissue List HepG2; A549; Huh7; TIME; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000279488.8; ENST00000548755.1; ENST00000308385.6
External Link RMBase: m6A_site_201404
mod ID: M6ASITE014507 Click to Show/Hide the Full List
mod site chr12:89352292-89352293:- [6]
Sequence ATTTCATTCACTGGGGAGGAACAAAAACTATCTGGGCAGCT
Motif Score 2.951386905
Cell/Tissue List HepG2; A549; Huh7; TIME; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000548755.1; ENST00000279488.8
External Link RMBase: m6A_site_201405
mod ID: M6ASITE014508 Click to Show/Hide the Full List
mod site chr12:89352358-89352359:- [6]
Sequence GAGGGATTAGAAGCCGCTAGACTTTTTTTCCTCCCCTCTCA
Motif Score 3.319380952
Cell/Tissue List HepG2; A549; hNPCs; hESCs; fibroblasts; Huh7; CD4T; peripheral-blood; GSC-11; MSC; TIME; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000308385.6; ENST00000548755.1; ENST00000279488.8
External Link RMBase: m6A_site_201407