m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00232)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
DUSP2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Caco-2 cell line | Homo sapiens |
|
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
|
GSE167075 | |
| Regulation |
![]() ![]() |
logFC: 7.70E-01 p-value: 1.05E-14 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3-mediated formation of EV miR-93, facilitated by m6A, is implicated in the aberrant cross-talk of epithelium-macrophages, indicating that this process is involved in the smoking-related emphysema. EV miR-93 was used as a novel risk biomarker for CS-induced emphysema. MiR-93 activated the JNK pathway by targeting Dual specificity protein phosphatase 2 (DUSP2), which elevated the levels of matrix metalloproteinase 9 (MMP9) and matrix metalloproteinase 12 (MMP12) and induced elastin degradation, leading to emphysema. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Emphysema | ICD-11: CA21 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
Emphysema [ICD-11: CA21]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3-mediated formation of EV miR-93, facilitated by m6A, is implicated in the aberrant cross-talk of epithelium-macrophages, indicating that this process is involved in the smoking-related emphysema. EV miR-93 was used as a novel risk biomarker for CS-induced emphysema. MiR-93 activated the JNK pathway by targeting Dual specificity protein phosphatase 2 (DUSP2), which elevated the levels of matrix metalloproteinase 9 (MMP9) and matrix metalloproteinase 12 (MMP12) and induced elastin degradation, leading to emphysema. | |||
| Responsed Disease | Emphysema [ICD-11: CA21] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00232)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE002379 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143688-96143689:- | [3] | |
| Sequence | CTCAGAGTTTCAGAAGCCCCCACATGGGGGCTCTAGGAATG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m5C_site_26881 | ||
| mod ID: M5CSITE002380 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143689-96143690:- | [3] | |
| Sequence | CCTCAGAGTTTCAGAAGCCCCCACATGGGGGCTCTAGGAAT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m5C_site_26882 | ||
| mod ID: M5CSITE002381 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143690-96143691:- | [3] | |
| Sequence | TCCTCAGAGTTTCAGAAGCCCCCACATGGGGGCTCTAGGAA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m5C_site_26883 | ||
| mod ID: M5CSITE002382 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143691-96143692:- | [3] | |
| Sequence | CTCCTCAGAGTTTCAGAAGCCCCCACATGGGGGCTCTAGGA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m5C_site_26884 | ||
N6-methyladenosine (m6A)
| In total 13 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE046232 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143384-96143385:- | [4] | |
| Sequence | TGTTCCTGGGGAAGCTGGGGACTTGGGAAGTGATGGGTGTG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483812 | ||
| mod ID: M6ASITE046233 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143471-96143472:- | [4] | |
| Sequence | CAGCCTGAGAGCTCCAAGGAACAAGCTGTGACAACCAGGAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483813 | ||
| mod ID: M6ASITE046234 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143594-96143595:- | [4] | |
| Sequence | GCCCTCATTCGGGGTCGGGAACCAAGGGTGTGTCTGCTCTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483814 | ||
| mod ID: M6ASITE046235 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143624-96143625:- | [4] | |
| Sequence | TGGTGCTCTTCTGCTGGGGGACTGAGGCTGGCCCTCATTCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483815 | ||
| mod ID: M6ASITE046236 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143768-96143769:- | [4] | |
| Sequence | CTGGCAGGAGCTGACTGTGGACTGGTGGGCTCCCCTCTGGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; H1A; H1B; GM12878; CD8T; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000488952.1; ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483816 | ||
| mod ID: M6ASITE046237 | Click to Show/Hide the Full List | ||
| mod site | chr2:96143842-96143843:- | [4] | |
| Sequence | GGCAGCTGCTGCAGTTTGAGACCCAGGTGCTGTGTCACTGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; GM12878; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000488952.1; ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483817 | ||
| mod ID: M6ASITE046238 | Click to Show/Hide the Full List | ||
| mod site | chr2:96144024-96144025:- | [4] | |
| Sequence | CCTTGCAGACTGGGTGAAGAACAGCGGAGGCCGGGTGCTGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000488952.1; ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483818 | ||
| mod ID: M6ASITE046239 | Click to Show/Hide the Full List | ||
| mod site | chr2:96144484-96144485:- | [4] | |
| Sequence | ACCTGTCTCAGGTCAGGAGGACTGGCTGAGGAGTCCTCTTG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000488952.1; ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483819 | ||
| mod ID: M6ASITE046241 | Click to Show/Hide the Full List | ||
| mod site | chr2:96144798-96144799:- | [4] | |
| Sequence | TGCCGCCAACAGGGGACAAAACCAGCCGCTCCGACTCCAGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483820 | ||
| mod ID: M6ASITE046242 | Click to Show/Hide the Full List | ||
| mod site | chr2:96144803-96144804:- | [4] | |
| Sequence | TGCGCTGCCGCCAACAGGGGACAAAACCAGCCGCTCCGACT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483821 | ||
| mod ID: M6ASITE046243 | Click to Show/Hide the Full List | ||
| mod site | chr2:96145002-96145003:- | [4] | |
| Sequence | TGGCCGCGCTGCTGCACGAGACCCGCGCGGGGCCCACTGCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; MT4; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483822 | ||
| mod ID: M6ASITE046244 | Click to Show/Hide the Full List | ||
| mod site | chr2:96145262-96145263:- | [5] | |
| Sequence | GGAACGCACGCTGCTGCTGGACTGCCGCCCCTTCCTGGCCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; Jurkat; CD4T; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483823 | ||
| mod ID: M6ASITE046245 | Click to Show/Hide the Full List | ||
| mod site | chr2:96145385-96145386:- | [4] | |
| Sequence | GAGCCCGGGACGCGGGAAAGACCGAAAGGAAGAGGAAGAGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; H1A; MT4; Jurkat; CD4T; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000288943.5 | ||
| External Link | RMBase: m6A_site_483824 | ||
References

