m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00225)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
DDIT4
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | LX2 cell line | Homo sapiens |
|
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
|
GSE207909 | |
| Regulation |
![]() ![]() |
logFC: 1.24E+00 p-value: 1.11E-27 |
| More Results | Click to View More RNA-seq Results | |
| In total 3 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Pathway Response | mTOR signaling pathway | hsa04150 | ||
| HIF-1 signaling pathway | hsa04066 | |||
| In-vivo Model | The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer. | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Non-alcoholic fatty liver disease | ICD-11: DB92 | ||
| Pathway Response | mTOR signaling pathway | hsa04150 | ||
| HIF-1 signaling pathway | hsa04066 | |||
| In-vivo Model | The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer. | |||
| Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | METTL3 knockout in the limbal stem cells promotes the in vivo cell proliferation and migration, leading to the fast repair of corneal injury. In addition, m6A modification profiling identified stem cell regulatory factors AHNAK and DNA damage-inducible transcript 4 protein (DDIT4) as m6A targets. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Corneal injury | ICD-11: NA06.4 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| In-vitro Model | CGC (Conjunctival goblet cells) | |||
| In-vivo Model | Mettl3fl/wt mice were generated as previously described. Mettl3fl/wt mice were crossed with K14CreER mice to obtain K14creER/Mettl3fl/fl (cKO) mice. Mettl3 cKO and control mice were injected with tamoxifen and then were subjected to corneal alkali burn treatment. The right eye was the experimental eye, and the left eye was the control eye. The mice were sacrificed at 24 hours, 7 days, 14 days, 35 days, and 56 days after injury. Six mice were taken from each period. Both eyes were removed, frozen in OCT (n = 4), fixed in 4% paraformaldehyde, and embedded in conventional paraffin (n = 2). | |||
Obesity [ICD-11: 5B81]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4. | |||
| Responsed Disease | Obesity [ICD-11: 5B81] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | mTOR signaling pathway | hsa04150 | ||
| HIF-1 signaling pathway | hsa04066 | |||
| In-vivo Model | The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer. | |||
Non-alcoholic fatty liver disease [ICD-11: DB92]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4. | |||
| Responsed Disease | Non-alcoholic fatty liver disease [ICD-11: DB92] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | mTOR signaling pathway | hsa04150 | ||
| HIF-1 signaling pathway | hsa04066 | |||
| In-vivo Model | The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer. | |||
Corneal injury [ICD-11: NA06]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | METTL3 knockout in the limbal stem cells promotes the in vivo cell proliferation and migration, leading to the fast repair of corneal injury. In addition, m6A modification profiling identified stem cell regulatory factors AHNAK and DNA damage-inducible transcript 4 protein (DDIT4) as m6A targets. | |||
| Responsed Disease | Corneal injury [ICD-11: NA06.4] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| In-vitro Model | CGC (Conjunctival goblet cells) | |||
| In-vivo Model | Mettl3fl/wt mice were generated as previously described. Mettl3fl/wt mice were crossed with K14CreER mice to obtain K14creER/Mettl3fl/fl (cKO) mice. Mettl3 cKO and control mice were injected with tamoxifen and then were subjected to corneal alkali burn treatment. The right eye was the experimental eye, and the left eye was the control eye. The mice were sacrificed at 24 hours, 7 days, 14 days, 35 days, and 56 days after injury. Six mice were taken from each period. Both eyes were removed, frozen in OCT (n = 4), fixed in 4% paraformaldehyde, and embedded in conventional paraffin (n = 2). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00225)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE004715 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274691-72274692:+ | [4] | |
| Sequence | TTCCTGTGTGCTCTCCTTTCCAGACACGGCTTACCTGGATG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000307365.4; ENST00000473155.1 | ||
| External Link | RMBase: m5C_site_5479 | ||
N6-methyladenosine (m6A)
| In total 55 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE000789 | Click to Show/Hide the Full List | ||
| mod site | chr10:72273954-72273955:+ | [5] | |
| Sequence | AGGGGGAGGTGCGAGCGTGGACCTGGGACGGGTCTGGGCGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105285 | ||
| mod ID: M6ASITE000790 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274000-72274001:+ | [6] | |
| Sequence | GGTGGTTGGCACGGGTTCGCACACCCATTCAAGCGGCAGGA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105286 | ||
| mod ID: M6ASITE000791 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274121-72274122:+ | [5] | |
| Sequence | TGGTCTGGTCTGGTCCCCAGACTGACGCCTGGTCGGTCCCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; Huh7; peripheral-blood | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4; ENST00000471240.1 | ||
| External Link | RMBase: m6A_site_105287 | ||
| mod ID: M6ASITE000792 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274232-72274233:+ | [5] | |
| Sequence | CACCATGCCTAGCCTTTGGGACCGCTTCTCGTCGTCGTCCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; HEK293T; iSLK; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471240.1; ENST00000473155.1; ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105288 | ||
| mod ID: M6ASITE000793 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274282-72274283:+ | [5] | |
| Sequence | CGCCCTCGTCCTTGCCCCGAACTCCCACCCCAGATCGGCCG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; HEK293T; iSLK; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4; ENST00000471240.1 | ||
| External Link | RMBase: m6A_site_105289 | ||
| mod ID: M6ASITE000794 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274373-72274374:+ | [5] | |
| Sequence | CACGAGCCTGGAGAGCTCGGACTGCGAGTCCCTGGACAGCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; peripheral-blood; HEK293T; iSLK; TIME; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471240.1; ENST00000307365.4; ENST00000473155.1 | ||
| External Link | RMBase: m6A_site_105290 | ||
| mod ID: M6ASITE000795 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274388-72274389:+ | [5] | |
| Sequence | CTCGGACTGCGAGTCCCTGGACAGCAGCAACAGTGGCTTCG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; MM6; peripheral-blood; HEK293T; iSLK; TIME; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471240.1; ENST00000473155.1; ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105291 | ||
| mod ID: M6ASITE000796 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274524-72274525:+ | [5] | |
| Sequence | TGGCTTCCTATCCCATCGGGACCCAGATTGCTTGGGGGCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; MM6; Jurkat; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4; ENST00000471240.1 | ||
| External Link | RMBase: m6A_site_105292 | ||
| mod ID: M6ASITE000797 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274578-72274579:+ | [5] | |
| Sequence | ATAAGGTGAGTGAGGCGGAAACTGAGGCACGGAGTGGGAAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; MM6; Jurkat; CD4T; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4; ENST00000471240.1 | ||
| External Link | RMBase: m6A_site_105293 | ||
| mod ID: M6ASITE000798 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274620-72274621:+ | [5] | |
| Sequence | AGCGTTGGTTTCTTAAGGAAACAGCACCTCCCCCGCCTGTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; BGC823; U2OS; A549; GM12878; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000471240.1; ENST00000307365.4; ENST00000473155.1 | ||
| External Link | RMBase: m6A_site_105294 | ||
| mod ID: M6ASITE000799 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274694-72274695:+ | [6] | |
| Sequence | CTGTGTGCTCTCCTTTCCAGACACGGCTTACCTGGATGGGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105295 | ||
| mod ID: M6ASITE000800 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274758-72274759:+ | [5] | |
| Sequence | CTCAGTGACCCTGAGGATGAACACTTGTGTGCCAACCTGAT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1B; GM12878; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000473155.1; ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105296 | ||
| mod ID: M6ASITE000801 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274878-72274879:+ | [5] | |
| Sequence | GTAAGCCAGGTGGGCAAAGAACTACTGCGCCTGGCCTACAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000307365.4; ENST00000473155.1 | ||
| External Link | RMBase: m6A_site_105297 | ||
| mod ID: M6ASITE000802 | Click to Show/Hide the Full List | ||
| mod site | chr10:72274961-72274962:+ | [7] | |
| Sequence | GGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCAC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105298 | ||
| mod ID: M6ASITE000803 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275033-72275034:+ | [5] | |
| Sequence | GACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105299 | ||
| mod ID: M6ASITE000804 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275037-72275038:+ | [8] | |
| Sequence | CTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCA | ||
| Motif Score | 2.021232143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105300 | ||
| mod ID: M6ASITE000805 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275153-72275154:+ | [7] | |
| Sequence | AGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105303 | ||
| mod ID: M6ASITE000806 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275163-72275164:+ | [5] | |
| Sequence | AAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105304 | ||
| mod ID: M6ASITE000807 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275188-72275189:+ | [5] | |
| Sequence | TGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105305 | ||
| mod ID: M6ASITE000808 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275208-72275209:+ | [8] | |
| Sequence | ACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; A549 | ||
| Seq Type List | DART-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105306 | ||
| mod ID: M6ASITE000809 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275223-72275224:+ | [5] | |
| Sequence | GGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105307 | ||
| mod ID: M6ASITE000810 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275229-72275230:+ | [8] | |
| Sequence | CAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGG | ||
| Motif Score | 2.871321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105308 | ||
| mod ID: M6ASITE000811 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275232-72275233:+ | [8] | |
| Sequence | TGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGA | ||
| Motif Score | 3.287565476 | ||
| Cell/Tissue List | HEK293T; CD8T | ||
| Seq Type List | DART-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105309 | ||
| mod ID: M6ASITE000812 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275237-72275238:+ | [5] | |
| Sequence | TCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105310 | ||
| mod ID: M6ASITE000813 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275252-72275253:+ | [5] | |
| Sequence | ACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105311 | ||
| mod ID: M6ASITE000814 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275273-72275274:+ | [5] | |
| Sequence | CTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105312 | ||
| mod ID: M6ASITE000815 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275294-72275295:+ | [5] | |
| Sequence | CTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAAGGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105313 | ||
| mod ID: M6ASITE000816 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275381-72275382:+ | [9] | |
| Sequence | CGGGTGGCTGTGCATTGGGGACACATACCCCTCAGTACTGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | CD34; HepG2; HEK293T; HeLa; A549; hESC-HEK293T; U2OS; H1A; H1B; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105315 | ||
| mod ID: M6ASITE000817 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275383-72275384:+ | [8] | |
| Sequence | GGTGGCTGTGCATTGGGGACACATACCCCTCAGTACTGTAG | ||
| Motif Score | 2.084928571 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105316 | ||
| mod ID: M6ASITE000818 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275410-72275411:+ | [9] | |
| Sequence | CCTCAGTACTGTAGCATGAAACAAAGGCTTAGGGGCCAACA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | CD34; HepG2; HEK293T; HeLa; A549; U2OS; H1A; H1B; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105317 | ||
| mod ID: M6ASITE000819 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275428-72275429:+ | [8] | |
| Sequence | AAACAAAGGCTTAGGGGCCAACAAGGCTTCCAGCTGGATGT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105318 | ||
| mod ID: M6ASITE000820 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275462-72275463:+ | [8] | |
| Sequence | TGGATGTGTGTGTAGCATGTACCTTATTATTTTTGTTACTG | ||
| Motif Score | 2.8355 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105319 | ||
| mod ID: M6ASITE000821 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275479-72275480:+ | [8] | |
| Sequence | TGTACCTTATTATTTTTGTTACTGACAGTTAACAGTGGTGT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105320 | ||
| mod ID: M6ASITE000822 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275483-72275484:+ | [7] | |
| Sequence | CCTTATTATTTTTGTTACTGACAGTTAACAGTGGTGTGACA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293; HEK293T; hESC-HEK293T; AML | ||
| Seq Type List | m6A-REF-seq; DART-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105321 | ||
| mod ID: M6ASITE000823 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275490-72275491:+ | [8] | |
| Sequence | ATTTTTGTTACTGACAGTTAACAGTGGTGTGACATCCAGAG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105322 | ||
| mod ID: M6ASITE000824 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275501-72275502:+ | [8] | |
| Sequence | TGACAGTTAACAGTGGTGTGACATCCAGAGAGCAGCTGGGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105323 | ||
| mod ID: M6ASITE000825 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275561-72275562:+ | [8] | |
| Sequence | CCCAGGGTGAAGGAAGAGGCACGTGCTCCTCAGAGCAGCCG | ||
| Motif Score | 2.80452381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105324 | ||
| mod ID: M6ASITE000826 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275628-72275629:+ | [8] | |
| Sequence | GGAGGTGGTTTGTGTATCTTACTGGTCTGAAGGGACCAAGT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105325 | ||
| mod ID: M6ASITE000827 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275642-72275643:+ | [9] | |
| Sequence | TATCTTACTGGTCTGAAGGGACCAAGTGTGTTTGTTGTTTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | CD34; U2OS; MT4; Huh7; iSLK; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105326 | ||
| mod ID: M6ASITE000828 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275694-72275695:+ | [8] | |
| Sequence | GTTTTTCTGATCGGAGCATCACTACTGACCTGTTGTAGGCA | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105327 | ||
| mod ID: M6ASITE000829 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275727-72275728:+ | [8] | |
| Sequence | TGTAGGCAGCTATCTTACAGACGCATGAATGTAAGAGTAGG | ||
| Motif Score | 2.871321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105328 | ||
| mod ID: M6ASITE000830 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275783-72275784:+ | [6] | |
| Sequence | GGGATCACTTGGGATCTTTGACACTTGAAAAATTACACCTG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105329 | ||
| mod ID: M6ASITE000831 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275797-72275798:+ | [6] | |
| Sequence | TCTTTGACACTTGAAAAATTACACCTGGCAGCTGCGTTTAA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105330 | ||
| mod ID: M6ASITE000832 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275835-72275836:+ | [8] | |
| Sequence | TAAGCCTTCCCCCATCGTGTACTGCAGAGTTGAGCTGGCAG | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105331 | ||
| mod ID: M6ASITE000833 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275884-72275885:+ | [9] | |
| Sequence | CTGAGAGGGTGGGGGCTGGAACCCCTCCCCGGGAGGAGTGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | CD34; MT4; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105332 | ||
| mod ID: M6ASITE000834 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275926-72275927:+ | [5] | |
| Sequence | ATCTGGGTCTTCCATCTAGAACTGTTTACATGAAGATAAGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105334 | ||
| mod ID: M6ASITE000835 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275933-72275934:+ | [8] | |
| Sequence | TCTTCCATCTAGAACTGTTTACATGAAGATAAGATACTCAC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105336 | ||
| mod ID: M6ASITE000836 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275948-72275949:+ | [8] | |
| Sequence | TGTTTACATGAAGATAAGATACTCACTGTTCATGAATACAC | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105337 | ||
| mod ID: M6ASITE000837 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275952-72275953:+ | [8] | |
| Sequence | TACATGAAGATAAGATACTCACTGTTCATGAATACACTTGA | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105338 | ||
| mod ID: M6ASITE000838 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275965-72275966:+ | [6] | |
| Sequence | GATACTCACTGTTCATGAATACACTTGATGTTCAAGTATTA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105340 | ||
| mod ID: M6ASITE000839 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275967-72275968:+ | [8] | |
| Sequence | TACTCACTGTTCATGAATACACTTGATGTTCAAGTATTAAG | ||
| Motif Score | 2.506922619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105341 | ||
| mod ID: M6ASITE000840 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275988-72275989:+ | [5] | |
| Sequence | CTTGATGTTCAAGTATTAAGACCTATGCAATATTTTTTACT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105343 | ||
| mod ID: M6ASITE000841 | Click to Show/Hide the Full List | ||
| mod site | chr10:72276006-72276007:+ | [8] | |
| Sequence | AGACCTATGCAATATTTTTTACTTTTCTAATAAACATGTTT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105344 | ||
| mod ID: M6ASITE000842 | Click to Show/Hide the Full List | ||
| mod site | chr10:72276019-72276020:+ | [5] | |
| Sequence | ATTTTTTACTTTTCTAATAAACATGTTTGTTAAAACAGTTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; Huh7 | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105345 | ||
| mod ID: M6ASITE000843 | Click to Show/Hide the Full List | ||
| mod site | chr10:72276033-72276034:+ | [5] | |
| Sequence | TAATAAACATGTTTGTTAAAACAGTTGGTTGAGTCTCTCAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: m6A_site_105346 | ||
2'-O-Methylation (2'-O-Me)
| In total 3 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000571 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275042-72275043:+ | [10] | |
| Sequence | GCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGC | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: Nm_site_749 | ||
| mod ID: 2OMSITE000572 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275171-72275172:+ | [10] | |
| Sequence | GTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTT | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: Nm_site_750 | ||
| mod ID: 2OMSITE000573 | Click to Show/Hide the Full List | ||
| mod site | chr10:72275844-72275845:+ | [10] | |
| Sequence | CCCCATCGTGTACTGCAGAGTTGAGCTGGCAGGGGAGGGGC | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000307365.4 | ||
| External Link | RMBase: Nm_site_751 | ||
References

