m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00225)

Target Name	DNA damage-inducible transcript 4 protein (DDIT4)
Synonyms	HIF-1 responsive protein RTP801; Protein regulated in development and DNA damage response 1; REDD-1; REDD1; RTP801 Click to Show/Hide
Gene Name	DDIT4
Chromosomal Location	10q22.1
Family	DDIT4 family
Function	Regulates cell growth, proliferation and survival via inhibition of the activity of the mammalian target of rapamycin complex 1 (mTORC1). Inhibition of mTORC1 is mediated by a pathway that involves DDIT4/REDD1, AKT1, the TSC1-TSC2 complex and the GTPase RHEB. Plays an important role in responses to cellular energy levels and cellular stress, including responses to hypoxia and DNA damage. Regulates p53/TP53-mediated apoptosis in response to DNA damage via its effect on mTORC1 activity. Its role in the response to hypoxia depends on the cell type; it mediates mTORC1 inhibition in fibroblasts and thymocytes, but not in hepatocytes (By similarity). Required for mTORC1-mediated defense against viral protein synthesis and virus replication (By similarity). Inhibits neuronal differentiation and neurite outgrowth mediated by NGF via its effect on mTORC1 activity. Required for normal neuron migration during embryonic brain development. Plays a role in neuronal cell death. Click to Show/Hide
Gene ID	54541
Uniprot ID	DDIT4_HUMAN
HGNC ID	HGNC:24944
KEGG ID	hsa:54541

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

DDIT4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 1.24E+00 p-value: 1.11E-27
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Target Regulation	Down regulation
Responsed Disease	Obesity	ICD-11: 5B81	Disease Info
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Target Regulation	Down regulation
Responsed Disease	Non-alcoholic fatty liver disease	ICD-11: DB92	Disease Info
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	METTL3 knockout in the limbal stem cells promotes the in vivo cell proliferation and migration, leading to the fast repair of corneal injury. In addition, m6A modification profiling identified stem cell regulatory factors AHNAK and DNA damage-inducible transcript 4 protein (DDIT4) as m6A targets.
Target Regulation	Up regulation
Responsed Disease	Corneal injury	ICD-11: NA06.4	Disease Info
Cell Process	Cell proliferation
	Cell migration
In-vitro Model	CGC (Conjunctival goblet cells)
In-vivo Model	Mettl3^fl/wt mice were generated as previously described. Mettl3^fl/wt mice were crossed with K14CreER mice to obtain K14^creER/Mettl3^fl/fl (cKO) mice. Mettl3 cKO and control mice were injected with tamoxifen and then were subjected to corneal alkali burn treatment. The right eye was the experimental eye, and the left eye was the control eye. The mice were sacrificed at 24 hours, 7 days, 14 days, 35 days, and 56 days after injury. Six mice were taken from each period. Both eyes were removed, frozen in OCT (n = 4), fixed in 4% paraformaldehyde, and embedded in conventional paraffin (n = 2).

Obesity [ICD-11: 5B81]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.

Non-alcoholic fatty liver disease [ICD-11: DB92]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	The contribution of METTL3-mediated m6A modification of DNA damage-inducible transcript 4 protein (DDIT4) mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and nuclear factor Kappa-B (NF-Kappa-B) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Responsed Disease	Non-alcoholic fatty liver disease [ICD-11: DB92]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.

Corneal injury [ICD-11: NA06]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 knockout in the limbal stem cells promotes the in vivo cell proliferation and migration, leading to the fast repair of corneal injury. In addition, m6A modification profiling identified stem cell regulatory factors AHNAK and DNA damage-inducible transcript 4 protein (DDIT4) as m6A targets.
Responsed Disease	Corneal injury [ICD-11: NA06.4]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation
	Cell migration
In-vitro Model	CGC (Conjunctival goblet cells)
In-vivo Model	Mettl3^fl/wt mice were generated as previously described. Mettl3^fl/wt mice were crossed with K14CreER mice to obtain K14^creER/Mettl3^fl/fl (cKO) mice. Mettl3 cKO and control mice were injected with tamoxifen and then were subjected to corneal alkali burn treatment. The right eye was the experimental eye, and the left eye was the control eye. The mice were sacrificed at 24 hours, 7 days, 14 days, 35 days, and 56 days after injury. Six mice were taken from each period. Both eyes were removed, frozen in OCT (n = 4), fixed in 4% paraformaldehyde, and embedded in conventional paraffin (n = 2).

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00225)

DNA damage-inducible transcript 4 protein (DDIT4)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004715		Click to Show/Hide the Full List
mod site	chr10:72274691-72274692:+		[4]
Sequence	TTCCTGTGTGCTCTCCTTTCCAGACACGGCTTACCTGGATG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000307365.4; ENST00000473155.1
External Link	RMBase: m5C_site_5479

N6-methyladenosine (m6A)

In total 55 m6A sequence/site(s) in this target gene
mod ID: M6ASITE000789		Click to Show/Hide the Full List
mod site	chr10:72273954-72273955:+		[5]
Sequence	AGGGGGAGGTGCGAGCGTGGACCTGGGACGGGTCTGGGCGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4
External Link	RMBase: m6A_site_105285
mod ID: M6ASITE000790		Click to Show/Hide the Full List
mod site	chr10:72274000-72274001:+		[6]
Sequence	GGTGGTTGGCACGGGTTCGCACACCCATTCAAGCGGCAGGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4
External Link	RMBase: m6A_site_105286
mod ID: M6ASITE000791		Click to Show/Hide the Full List
mod site	chr10:72274121-72274122:+		[5]
Sequence	TGGTCTGGTCTGGTCCCCAGACTGACGCCTGGTCGGTCCCC
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4; ENST00000471240.1
External Link	RMBase: m6A_site_105287
mod ID: M6ASITE000792		Click to Show/Hide the Full List
mod site	chr10:72274232-72274233:+		[5]
Sequence	CACCATGCCTAGCCTTTGGGACCGCTTCTCGTCGTCGTCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; HEK293T; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471240.1; ENST00000473155.1; ENST00000307365.4
External Link	RMBase: m6A_site_105288
mod ID: M6ASITE000793		Click to Show/Hide the Full List
mod site	chr10:72274282-72274283:+		[5]
Sequence	CGCCCTCGTCCTTGCCCCGAACTCCCACCCCAGATCGGCCG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; MM6; Huh7; peripheral-blood; HEK293T; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4; ENST00000471240.1
External Link	RMBase: m6A_site_105289
mod ID: M6ASITE000794		Click to Show/Hide the Full List
mod site	chr10:72274373-72274374:+		[5]
Sequence	CACGAGCCTGGAGAGCTCGGACTGCGAGTCCCTGGACAGCA
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; MM6; peripheral-blood; HEK293T; iSLK; TIME; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471240.1; ENST00000307365.4; ENST00000473155.1
External Link	RMBase: m6A_site_105290
mod ID: M6ASITE000795		Click to Show/Hide the Full List
mod site	chr10:72274388-72274389:+		[5]
Sequence	CTCGGACTGCGAGTCCCTGGACAGCAGCAACAGTGGCTTCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; MM6; peripheral-blood; HEK293T; iSLK; TIME; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471240.1; ENST00000473155.1; ENST00000307365.4
External Link	RMBase: m6A_site_105291
mod ID: M6ASITE000796		Click to Show/Hide the Full List
mod site	chr10:72274524-72274525:+		[5]
Sequence	TGGCTTCCTATCCCATCGGGACCCAGATTGCTTGGGGGCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; MM6; Jurkat; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4; ENST00000471240.1
External Link	RMBase: m6A_site_105292
mod ID: M6ASITE000797		Click to Show/Hide the Full List
mod site	chr10:72274578-72274579:+		[5]
Sequence	ATAAGGTGAGTGAGGCGGAAACTGAGGCACGGAGTGGGAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; MM6; Jurkat; CD4T; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4; ENST00000471240.1
External Link	RMBase: m6A_site_105293
mod ID: M6ASITE000798		Click to Show/Hide the Full List
mod site	chr10:72274620-72274621:+		[5]
Sequence	AGCGTTGGTTTCTTAAGGAAACAGCACCTCCCCCGCCTGTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; BGC823; U2OS; A549; GM12878; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471240.1; ENST00000307365.4; ENST00000473155.1
External Link	RMBase: m6A_site_105294
mod ID: M6ASITE000799		Click to Show/Hide the Full List
mod site	chr10:72274694-72274695:+		[6]
Sequence	CTGTGTGCTCTCCTTTCCAGACACGGCTTACCTGGATGGGG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000473155.1; ENST00000307365.4
External Link	RMBase: m6A_site_105295
mod ID: M6ASITE000800		Click to Show/Hide the Full List
mod site	chr10:72274758-72274759:+		[5]
Sequence	CTCAGTGACCCTGAGGATGAACACTTGTGTGCCAACCTGAT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; BGC823; U2OS; H1B; GM12878; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000473155.1; ENST00000307365.4
External Link	RMBase: m6A_site_105296
mod ID: M6ASITE000801		Click to Show/Hide the Full List
mod site	chr10:72274878-72274879:+		[5]
Sequence	GTAAGCCAGGTGGGCAAAGAACTACTGCGCCTGGCCTACAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000307365.4; ENST00000473155.1
External Link	RMBase: m6A_site_105297
mod ID: M6ASITE000802		Click to Show/Hide the Full List
mod site	chr10:72274961-72274962:+		[7]
Sequence	GGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCAC
Motif Score	2.053113095
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105298
mod ID: M6ASITE000803		Click to Show/Hide the Full List
mod site	chr10:72275033-72275034:+		[5]
Sequence	GACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105299
mod ID: M6ASITE000804		Click to Show/Hide the Full List
mod site	chr10:72275037-72275038:+		[8]
Sequence	CTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCA
Motif Score	2.021232143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105300
mod ID: M6ASITE000805		Click to Show/Hide the Full List
mod site	chr10:72275153-72275154:+		[7]
Sequence	AGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCA
Motif Score	2.856142857
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105303
mod ID: M6ASITE000806		Click to Show/Hide the Full List
mod site	chr10:72275163-72275164:+		[5]
Sequence	AAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105304
mod ID: M6ASITE000807		Click to Show/Hide the Full List
mod site	chr10:72275188-72275189:+		[5]
Sequence	TGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105305
mod ID: M6ASITE000808		Click to Show/Hide the Full List
mod site	chr10:72275208-72275209:+		[8]
Sequence	ACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAG
Motif Score	2.865571429
Cell/Tissue List	HEK293T; hESC-HEK293T; A549
Seq Type List	DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105306
mod ID: M6ASITE000809		Click to Show/Hide the Full List
mod site	chr10:72275223-72275224:+		[5]
Sequence	GGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105307
mod ID: M6ASITE000810		Click to Show/Hide the Full List
mod site	chr10:72275229-72275230:+		[8]
Sequence	CAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGG
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105308
mod ID: M6ASITE000811		Click to Show/Hide the Full List
mod site	chr10:72275232-72275233:+		[8]
Sequence	TGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGA
Motif Score	3.287565476
Cell/Tissue List	HEK293T; CD8T
Seq Type List	DART-seq; m6A-CLIP/IP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105309
mod ID: M6ASITE000812		Click to Show/Hide the Full List
mod site	chr10:72275237-72275238:+		[5]
Sequence	TCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105310
mod ID: M6ASITE000813		Click to Show/Hide the Full List
mod site	chr10:72275252-72275253:+		[5]
Sequence	ACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGG
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105311
mod ID: M6ASITE000814		Click to Show/Hide the Full List
mod site	chr10:72275273-72275274:+		[5]
Sequence	CTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105312
mod ID: M6ASITE000815		Click to Show/Hide the Full List
mod site	chr10:72275294-72275295:+		[5]
Sequence	CTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAAGGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105313
mod ID: M6ASITE000816		Click to Show/Hide the Full List
mod site	chr10:72275381-72275382:+		[9]
Sequence	CGGGTGGCTGTGCATTGGGGACACATACCCCTCAGTACTGT
Motif Score	3.643047619
Cell/Tissue List	CD34; HepG2; HEK293T; HeLa; A549; hESC-HEK293T; U2OS; H1A; H1B; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105315
mod ID: M6ASITE000817		Click to Show/Hide the Full List
mod site	chr10:72275383-72275384:+		[8]
Sequence	GGTGGCTGTGCATTGGGGACACATACCCCTCAGTACTGTAG
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105316
mod ID: M6ASITE000818		Click to Show/Hide the Full List
mod site	chr10:72275410-72275411:+		[9]
Sequence	CCTCAGTACTGTAGCATGAAACAAAGGCTTAGGGGCCAACA
Motif Score	2.20572619
Cell/Tissue List	CD34; HepG2; HEK293T; HeLa; A549; U2OS; H1A; H1B; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105317
mod ID: M6ASITE000819		Click to Show/Hide the Full List
mod site	chr10:72275428-72275429:+		[8]
Sequence	AAACAAAGGCTTAGGGGCCAACAAGGCTTCCAGCTGGATGT
Motif Score	2.173910714
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105318
mod ID: M6ASITE000820		Click to Show/Hide the Full List
mod site	chr10:72275462-72275463:+		[8]
Sequence	TGGATGTGTGTGTAGCATGTACCTTATTATTTTTGTTACTG
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105319
mod ID: M6ASITE000821		Click to Show/Hide the Full List
mod site	chr10:72275479-72275480:+		[8]
Sequence	TGTACCTTATTATTTTTGTTACTGACAGTTAACAGTGGTGT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105320
mod ID: M6ASITE000822		Click to Show/Hide the Full List
mod site	chr10:72275483-72275484:+		[7]
Sequence	CCTTATTATTTTTGTTACTGACAGTTAACAGTGGTGTGACA
Motif Score	2.859755952
Cell/Tissue List	HEK293; HEK293T; hESC-HEK293T; AML
Seq Type List	m6A-REF-seq; DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105321
mod ID: M6ASITE000823		Click to Show/Hide the Full List
mod site	chr10:72275490-72275491:+		[8]
Sequence	ATTTTTGTTACTGACAGTTAACAGTGGTGTGACATCCAGAG
Motif Score	2.168095238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105322
mod ID: M6ASITE000824		Click to Show/Hide the Full List
mod site	chr10:72275501-72275502:+		[8]
Sequence	TGACAGTTAACAGTGGTGTGACATCCAGAGAGCAGCTGGGC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105323
mod ID: M6ASITE000825		Click to Show/Hide the Full List
mod site	chr10:72275561-72275562:+		[8]
Sequence	CCCAGGGTGAAGGAAGAGGCACGTGCTCCTCAGAGCAGCCG
Motif Score	2.80452381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105324
mod ID: M6ASITE000826		Click to Show/Hide the Full List
mod site	chr10:72275628-72275629:+		[8]
Sequence	GGAGGTGGTTTGTGTATCTTACTGGTCTGAAGGGACCAAGT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105325
mod ID: M6ASITE000827		Click to Show/Hide the Full List
mod site	chr10:72275642-72275643:+		[9]
Sequence	TATCTTACTGGTCTGAAGGGACCAAGTGTGTTTGTTGTTTG
Motif Score	3.622404762
Cell/Tissue List	CD34; U2OS; MT4; Huh7; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105326
mod ID: M6ASITE000828		Click to Show/Hide the Full List
mod site	chr10:72275694-72275695:+		[8]
Sequence	GTTTTTCTGATCGGAGCATCACTACTGACCTGTTGTAGGCA
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105327
mod ID: M6ASITE000829		Click to Show/Hide the Full List
mod site	chr10:72275727-72275728:+		[8]
Sequence	TGTAGGCAGCTATCTTACAGACGCATGAATGTAAGAGTAGG
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105328
mod ID: M6ASITE000830		Click to Show/Hide the Full List
mod site	chr10:72275783-72275784:+		[6]
Sequence	GGGATCACTTGGGATCTTTGACACTTGAAAAATTACACCTG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105329
mod ID: M6ASITE000831		Click to Show/Hide the Full List
mod site	chr10:72275797-72275798:+		[6]
Sequence	TCTTTGACACTTGAAAAATTACACCTGGCAGCTGCGTTTAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105330
mod ID: M6ASITE000832		Click to Show/Hide the Full List
mod site	chr10:72275835-72275836:+		[8]
Sequence	TAAGCCTTCCCCCATCGTGTACTGCAGAGTTGAGCTGGCAG
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105331
mod ID: M6ASITE000833		Click to Show/Hide the Full List
mod site	chr10:72275884-72275885:+		[9]
Sequence	CTGAGAGGGTGGGGGCTGGAACCCCTCCCCGGGAGGAGTGC
Motif Score	2.930744048
Cell/Tissue List	CD34; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105332
mod ID: M6ASITE000834		Click to Show/Hide the Full List
mod site	chr10:72275926-72275927:+		[5]
Sequence	ATCTGGGTCTTCCATCTAGAACTGTTTACATGAAGATAAGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105334
mod ID: M6ASITE000835		Click to Show/Hide the Full List
mod site	chr10:72275933-72275934:+		[8]
Sequence	TCTTCCATCTAGAACTGTTTACATGAAGATAAGATACTCAC
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105336
mod ID: M6ASITE000836		Click to Show/Hide the Full List
mod site	chr10:72275948-72275949:+		[8]
Sequence	TGTTTACATGAAGATAAGATACTCACTGTTCATGAATACAC
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105337
mod ID: M6ASITE000837		Click to Show/Hide the Full List
mod site	chr10:72275952-72275953:+		[8]
Sequence	TACATGAAGATAAGATACTCACTGTTCATGAATACACTTGA
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105338
mod ID: M6ASITE000838		Click to Show/Hide the Full List
mod site	chr10:72275965-72275966:+		[6]
Sequence	GATACTCACTGTTCATGAATACACTTGATGTTCAAGTATTA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105340
mod ID: M6ASITE000839		Click to Show/Hide the Full List
mod site	chr10:72275967-72275968:+		[8]
Sequence	TACTCACTGTTCATGAATACACTTGATGTTCAAGTATTAAG
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105341
mod ID: M6ASITE000840		Click to Show/Hide the Full List
mod site	chr10:72275988-72275989:+		[5]
Sequence	CTTGATGTTCAAGTATTAAGACCTATGCAATATTTTTTACT
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105343
mod ID: M6ASITE000841		Click to Show/Hide the Full List
mod site	chr10:72276006-72276007:+		[8]
Sequence	AGACCTATGCAATATTTTTTACTTTTCTAATAAACATGTTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105344
mod ID: M6ASITE000842		Click to Show/Hide the Full List
mod site	chr10:72276019-72276020:+		[5]
Sequence	ATTTTTTACTTTTCTAATAAACATGTTTGTTAAAACAGTTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105345
mod ID: M6ASITE000843		Click to Show/Hide the Full List
mod site	chr10:72276033-72276034:+		[5]
Sequence	TAATAAACATGTTTGTTAAAACAGTTGGTTGAGTCTCTCAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: m6A_site_105346

2'-O-Methylation (2'-O-Me)

In total 3 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000571		Click to Show/Hide the Full List
mod site	chr10:72275042-72275043:+		[10]
Sequence	GCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: Nm_site_749
mod ID: 2OMSITE000572		Click to Show/Hide the Full List
mod site	chr10:72275171-72275172:+		[10]
Sequence	GTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: Nm_site_750
mod ID: 2OMSITE000573		Click to Show/Hide the Full List
mod site	chr10:72275844-72275845:+		[10]
Sequence	CCCCATCGTGTACTGCAGAGTTGAGCTGGCAGGGGAGGGGC
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000307365.4
External Link	RMBase: Nm_site_751

Ref 1	m(6)A mRNA methylation-directed myeloid cell activation controls progression of NAFLD and obesity. Cell Rep. 2021 Nov 9;37(6):109968. doi: 10.1016/j.celrep.2021.109968.
Ref 2	METTL3-Mediated m(6)A RNA Modification Regulates Corneal Injury Repair. Stem Cells Int. 2021 Oct 22;2021:5512153. doi: 10.1155/2021/5512153. eCollection 2021.
Ref 3	Loss of aromatase cytochrome P450 function as a risk factor for Parkinson's disease?. Brain Res Rev. 2008 Mar;57(2):431-43. doi: 10.1016/j.brainresrev.2007.10.011. Epub 2007 Nov 7.
Ref 4	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 10	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map