m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00208)

Target Name	G1/S-specific cyclin-E1 (CCNE1)
Synonyms	CCNE Click to Show/Hide
Gene Name	CCNE1
Chromosomal Location	19q12
Family	cyclin family; Cyclin E subfamily
Function	Essential for the control of the cell cycle at the G1/S (start) transition. Click to Show/Hide
Gene ID	898
Uniprot ID	CCNE1_HUMAN
HGNC ID	HGNC:1589
KEGG ID	hsa:898

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CCNE1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -1.64E+00 p-value: 3.22E-09
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between CCNE1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 6.94E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 promotes colorectal cancer proliferation by stabilizing G1/S-specific cyclin-E1 (CCNE1) mRNA in an m6A-dependent manner, representing a promising therapeutic strategy for the treatment of CRC.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
	Arrest cell cycle at G1 phase
In-vitro Model	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
In-vivo Model	LoVo cells (5 × 10⁶ cells/ 200 uL PBS) stably transfected with METTL3 knockdown lentiviral vector or control vector were respectively injected subcutaneously into the left flank of each mouse.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 promotes colorectal cancer proliferation by stabilizing G1/S-specific cyclin-E1 (CCNE1) mRNA in an m6A-dependent manner, representing a promising therapeutic strategy for the treatment of CRC.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
	Arrest cell cycle at G1 phase
In-vitro Model	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	LoVo	Colon adenocarcinoma	Homo sapiens	CVCL_0399
In-vivo Model	LoVo cells (5 × 10⁶ cells/ 200 uL PBS) stably transfected with METTL3 knockdown lentiviral vector or control vector were respectively injected subcutaneously into the left flank of each mouse.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03547		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03592		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00208)

G1/S-specific cyclin-E1 (CCNE1)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000256		Click to Show/Hide the Full List
mod site	chr19:29813003-29813004:+		[5]
Sequence	GATGAAGAAATGGCCAAAATCGACAGGACGGCGAGGGACCA
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000262643.8; ENST00000444983.6; ENST00000586912.1; ENST00000575243.5; ENST00000357943.9
External Link	RMBase: ac4C_site_988

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001881		Click to Show/Hide the Full List
mod site	chr19:29811999-29812000:+		[6]
Sequence	GAGCCGGGCGCAGGAGCAGCCGGCGCGGCCGCCAGCGCGGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000262643.8
External Link	RMBase: m5C_site_23849

N6-methyladenosine (m6A)

In total 39 m6A sequence/site(s) in this target gene
mod ID: M6ASITE040757		Click to Show/Hide the Full List
mod site	chr19:29812117-29812118:+		[7]
Sequence	CGCCGCCGCCGCCTGCCGGGACTGGAGCGCGCCGTCCGCCG
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; U2OS; GSC-11; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_4974009; ENST00000262643.8; ENST00000575243.5
External Link	RMBase: m6A_site_432392
mod ID: M6ASITE040758		Click to Show/Hide the Full List
mod site	chr19:29812141-29812142:+		[7]
Sequence	GAGCGCGCCGTCCGCCGCGGACAAGACCCTGGTGAGTCTAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; U2OS; CD4T; GSC-11; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000262643.8; ENST00000575243.5
External Link	RMBase: m6A_site_432393
mod ID: M6ASITE040759		Click to Show/Hide the Full List
mod site	chr19:29812146-29812147:+		[7]
Sequence	CGCCGTCCGCCGCGGACAAGACCCTGGTGAGTCTACTGCCG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; U2OS; CD4T; GSC-11; HEK293T; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000575243.5; ENST00000262643.8
External Link	RMBase: m6A_site_432394
mod ID: M6ASITE040760		Click to Show/Hide the Full List
mod site	chr19:29812705-29812706:+		[7]
Sequence	CAGGGATGCGAAGGAGCGGGACACCATGAAGGAGGACGGCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; U2OS; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000444983.6; ENST00000262643.8; ENST00000357943.9; ENST00000575243.5
External Link	RMBase: m6A_site_432395
mod ID: M6ASITE040761		Click to Show/Hide the Full List
mod site	chr19:29813020-29813021:+		[7]
Sequence	AATCGACAGGACGGCGAGGGACCAGTGTGGGAGCCAGGTAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; U2OS; MM6; Jurkat; peripheral-blood; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000262643.8; ENST00000586912.1; ENST00000357943.9; ENST00000444983.6; ENST00000575243.5
External Link	RMBase: m6A_site_432396
mod ID: M6ASITE040762		Click to Show/Hide the Full List
mod site	chr19:29817143-29817144:+		[8]
Sequence	TTTTCATTTACAGCCTTGGGACAATAATGCAGTCTGTGCAG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000262643.8; ENST00000575243.5; ENST00000357943.9; ENST00000444983.6
External Link	RMBase: m6A_site_432397
mod ID: M6ASITE040763		Click to Show/Hide the Full List
mod site	chr19:29817184-29817185:+		[8]
Sequence	ACCCCTGCTCCCTGATCCCCACACCTGACAAAGAAGATGAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000575243.5; ENST00000357943.9; ENST00000444983.6; ENST00000262643.8
External Link	RMBase: m6A_site_432398
mod ID: M6ASITE040764		Click to Show/Hide the Full List
mod site	chr19:29817191-29817192:+		[8]
Sequence	CTCCCTGATCCCCACACCTGACAAAGAAGATGATGACCGGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000575243.5; ENST00000262643.8; ENST00000357943.9; ENST00000444983.6
External Link	RMBase: m6A_site_432399
mod ID: M6ASITE040765		Click to Show/Hide the Full List
mod site	chr19:29817443-29817444:+		[7]
Sequence	AGTCTGGAAAATCATGTTAAACAAGGAAAAGACATACTTAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000262643.8; ENST00000444983.6; ENST00000357943.9; ENST00000576532.1; ENST00000575243.5
External Link	RMBase: m6A_site_432400
mod ID: M6ASITE040766		Click to Show/Hide the Full List
mod site	chr19:29817454-29817455:+		[7]
Sequence	TCATGTTAAACAAGGAAAAGACATACTTAAGGGATCAGCAC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000575243.5; ENST00000576532.1; ENST00000357943.9; ENST00000262643.8; ENST00000444983.6
External Link	RMBase: m6A_site_432401
mod ID: M6ASITE040767		Click to Show/Hide the Full List
mod site	chr19:29817486-29817487:+		[8]
Sequence	GATCAGCACTTTCTTGAGCAACACCCTCTTCTGCAGCCAAA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000444983.6; ENST00000576532.1; ENST00000575243.5; ENST00000262643.8; ENST00000357943.9
External Link	RMBase: m6A_site_432402
mod ID: M6ASITE040768		Click to Show/Hide the Full List
mod site	chr19:29820718-29820719:+		[7]
Sequence	CAGGTGTGTGAAGTCTATAAACTTCACAGGGAGACCTTTTA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000576532.1; ENST00000575243.5; ENST00000262643.8; ENST00000444983.6; ENST00000357943.9
External Link	RMBase: m6A_site_432403
mod ID: M6ASITE040769		Click to Show/Hide the Full List
mod site	chr19:29820775-29820776:+		[9]
Sequence	TTTGACCGGTATATGGCGACACAAGAAAATGTTGTAAAAAC
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000444983.6; ENST00000575243.5; ENST00000262643.8; ENST00000576532.1; ENST00000357943.9
External Link	RMBase: m6A_site_432404
mod ID: M6ASITE040770		Click to Show/Hide the Full List
mod site	chr19:29820794-29820795:+		[7]
Sequence	CACAAGAAAATGTTGTAAAAACTCTTTTACAGCTTATTGGG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000357943.9; ENST00000444983.6; ENST00000575243.5; ENST00000576532.1; ENST00000262643.8
External Link	RMBase: m6A_site_432405
mod ID: M6ASITE040771		Click to Show/Hide the Full List
mod site	chr19:29820841-29820842:+		[7]
Sequence	TCTTTATTTATTGCAGCCAAACTTGAGGTAAATAATTTTCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000444983.6; ENST00000575243.5; ENST00000262643.8; ENST00000357943.9; ENST00000576532.1
External Link	RMBase: m6A_site_432406
mod ID: M6ASITE040772		Click to Show/Hide the Full List
mod site	chr19:29822047-29822048:+		[8]
Sequence	TGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000574121.1; ENST00000576532.1; ENST00000444983.6; ENST00000357943.9; ENST00000262643.8
External Link	RMBase: m6A_site_432407
mod ID: M6ASITE040773		Click to Show/Hide the Full List
mod site	chr19:29822075-29822076:+		[8]
Sequence	GTTGCATATCTAAATGACTTACATGAAGTGCTACTGCCGCA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000262643.8; ENST00000576532.1; ENST00000444983.6; ENST00000357943.9; ENST00000574121.1
External Link	RMBase: m6A_site_432408
mod ID: M6ASITE040774		Click to Show/Hide the Full List
mod site	chr19:29822267-29822268:+		[9]
Sequence	TCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000444983.6; ENST00000262643.8; ENST00000576532.1; ENST00000574121.1; ENST00000357943.9
External Link	RMBase: m6A_site_432409
mod ID: M6ASITE040775		Click to Show/Hide the Full List
mod site	chr19:29822460-29822461:+		[8]
Sequence	TGCAGGGTATCAGTGGTGCGACATAGAGAACTGTGTCAAGT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000576532.1; ENST00000262643.8; ENST00000574121.1; ENST00000444983.6; ENST00000357943.9
External Link	RMBase: m6A_site_432410
mod ID: M6ASITE040776		Click to Show/Hide the Full List
mod site	chr19:29822469-29822470:+		[7]
Sequence	TCAGTGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTC
Motif Score	3.373380952
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000574121.1; ENST00000576532.1; ENST00000262643.8; ENST00000357943.9; ENST00000444983.6
External Link	RMBase: m6A_site_432411
mod ID: M6ASITE040777		Click to Show/Hide the Full List
mod site	chr19:29822527-29822528:+		[7]
Sequence	AGGGAGACGGGGAGCTCAAAACTGAAGCACTTCAGGGGCGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000574121.1; ENST00000357943.9; ENST00000444983.6; ENST00000262643.8; ENST00000576532.1
External Link	RMBase: m6A_site_432412
mod ID: M6ASITE040778		Click to Show/Hide the Full List
mod site	chr19:29822563-29822564:+		[8]
Sequence	GGCGTCGCTGATGAAGATGCACACAACATACAGACCCACAG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000444983.6; ENST00000357943.9; ENST00000574121.1; ENST00000576532.1; ENST00000262643.8
External Link	RMBase: m6A_site_432413
mod ID: M6ASITE040779		Click to Show/Hide the Full List
mod site	chr19:29822576-29822577:+		[7]
Sequence	AAGATGCACACAACATACAGACCCACAGAGACAGCTTGGAT
Motif Score	2.876744048
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000357943.9; ENST00000444983.6; ENST00000576532.1; ENST00000262643.8; ENST00000574121.1
External Link	RMBase: m6A_site_432414
mod ID: M6ASITE040780		Click to Show/Hide the Full List
mod site	chr19:29822586-29822587:+		[7]
Sequence	CAACATACAGACCCACAGAGACAGCTTGGATTTGCTGGTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000444983.6; ENST00000576532.1; ENST00000357943.9; ENST00000262643.8; ENST00000574121.1
External Link	RMBase: m6A_site_432415
mod ID: M6ASITE040781		Click to Show/Hide the Full List
mod site	chr19:29823689-29823690:+		[8]
Sequence	AAGAAAGCCATGTTGTCTGAACAAAATAGGGCTTCTCCTCT
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; MT4; A549; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000357943.9; ENST00000576532.1; ENST00000574121.1; ENST00000262643.8; ENST00000444983.6
External Link	RMBase: m6A_site_432416
mod ID: M6ASITE040782		Click to Show/Hide the Full List
mod site	chr19:29823734-29823735:+		[9]
Sequence	AGTGGGCTCCTCACCCCGCCACAGAGCGGTAAGAAGCAGAG
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000576532.1; ENST00000574121.1; ENST00000262643.8; ENST00000444983.6; ENST00000357943.9
External Link	RMBase: m6A_site_432417
mod ID: M6ASITE040783		Click to Show/Hide the Full List
mod site	chr19:29823801-29823802:+		[10]
Sequence	CCCATCCTTCTCCACCAAAGACAGTTGCGCGCCTGCTCCAC
Motif Score	2.897386905
Cell/Tissue List	A549; MT4; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000574121.1; ENST00000576532.1; ENST00000444983.6; ENST00000262643.8; ENST00000357943.9
External Link	RMBase: m6A_site_432418
mod ID: M6ASITE040784		Click to Show/Hide the Full List
mod site	chr19:29823864-29823865:+		[9]
Sequence	GGAGGCGTGCGTTTGCTTTTACAGATATCTGAATGGAAGAG
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000357943.9; ENST00000444983.6; ENST00000262643.8; ENST00000574121.1; ENST00000576532.1
External Link	RMBase: m6A_site_432419
mod ID: M6ASITE040785		Click to Show/Hide the Full List
mod site	chr19:29823898-29823899:+		[9]
Sequence	GGAAGAGTGTTTCTTCCACAACAGAAGTATTTCTGTGGATG
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000576532.1; ENST00000574121.1; ENST00000357943.9; ENST00000444983.6; ENST00000262643.8
External Link	RMBase: m6A_site_432420
mod ID: M6ASITE040786		Click to Show/Hide the Full List
mod site	chr19:29823986-29823987:+		[8]
Sequence	TTTAAATAAGTGGGTCAAGTACACCAGCCACCTCCAGACAC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000262643.8; ENST00000444983.6; ENST00000574121.1; ENST00000576532.1; ENST00000357943.9
External Link	RMBase: m6A_site_432421
mod ID: M6ASITE040787		Click to Show/Hide the Full List
mod site	chr19:29824003-29824004:+		[7]
Sequence	AGTACACCAGCCACCTCCAGACACCAGTGCGTGCTCCCGAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; H1B; hESCs; A549; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000357943.9; ENST00000444983.6; ENST00000262643.8; ENST00000576532.1; ENST00000574121.1
External Link	RMBase: m6A_site_432422
mod ID: M6ASITE040788		Click to Show/Hide the Full List
mod site	chr19:29824042-29824043:+		[9]
Sequence	ATGCTGCTATGGAAGGTGCTACTTGACCTAAGGGACTCCCA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000262643.8; ENST00000574121.1; ENST00000357943.9; ENST00000444983.6
External Link	RMBase: m6A_site_432423
mod ID: M6ASITE040789		Click to Show/Hide the Full List
mod site	chr19:29824056-29824057:+		[7]
Sequence	GGTGCTACTTGACCTAAGGGACTCCCACAACAACAAAAGCT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; H1B; hESCs; A549; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000357943.9; ENST00000444983.6; ENST00000574121.1; ENST00000262643.8
External Link	RMBase: m6A_site_432424
mod ID: M6ASITE040790		Click to Show/Hide the Full List
mod site	chr19:29824062-29824063:+		[8]
Sequence	ACTTGACCTAAGGGACTCCCACAACAACAAAAGCTTGAAGC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000357943.9; ENST00000574121.1; ENST00000262643.8; ENST00000444983.6
External Link	RMBase: m6A_site_432425
mod ID: M6ASITE040791		Click to Show/Hide the Full List
mod site	chr19:29824068-29824069:+		[8]
Sequence	CCTAAGGGACTCCCACAACAACAAAAGCTTGAAGCTGTGGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000574121.1; ENST00000444983.6; ENST00000262643.8; ENST00000357943.9
External Link	RMBase: m6A_site_432426
mod ID: M6ASITE040792		Click to Show/Hide the Full List
mod site	chr19:29824137-29824138:+		[9]
Sequence	GGTGTTCTGGGCTCCGTTGTACCAAGTGGAGCAGGTGGTTG
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000357943.9; ENST00000262643.8; ENST00000444983.6; ENST00000574121.1
External Link	RMBase: m6A_site_432427
mod ID: M6ASITE040793		Click to Show/Hide the Full List
mod site	chr19:29824212-29824213:+		[8]
Sequence	GGCAGGGGGCTGCCCTCTCCACATTATCAGTTGACAGTGTA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000574121.1; ENST00000262643.8; ENST00000357943.9
External Link	RMBase: m6A_site_432428
mod ID: M6ASITE040794		Click to Show/Hide the Full List
mod site	chr19:29824248-29824249:+		[7]
Sequence	GTGTACAATGCCTTTGATGAACTGTTTTGTAAGTGCTGCTA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000357943.9; ENST00000262643.8; ENST00000574121.1
External Link	RMBase: m6A_site_432429
mod ID: M6ASITE040795		Click to Show/Hide the Full List
mod site	chr19:29824309-29824310:+		[7]
Sequence	AAGATAATACTGTTTTTGAGACAGCTGGTTTTATGAGCTAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000262643.8
External Link	RMBase: m6A_site_432430

Ref 1	Methyltransferase like 3 promotes colorectal cancer proliferation by stabilizing CCNE1 mRNA in an m6A-dependent manner. J Cell Mol Med. 2020 Mar;24(6):3521-3533. doi: 10.1111/jcmm.15042. Epub 2020 Feb 10.
Ref 2	Pharmacokinetic interaction profile of riociguat, a new soluble guanylate cyclase stimulator, in?vitro. Pulm Pharmacol Ther. 2014 Aug;28(2):130-7. doi: 10.1016/j.pupt.2014.02.004. Epub 2014 Mar 21.
Ref 3	Nonclinical pharmacokinetics of oseltamivir and oseltamivir carboxylate in the central nervous system. Antimicrob Agents Chemother. 2009 Nov;53(11):4753-61. doi: 10.1128/AAC.01541-08. Epub 2009 Aug 31.
Ref 4	The influence of CYP3A5*3 and BCRPC421A genetic polymorphisms on the pharmacokinetics of felodipine in healthy Chinese volunteers. J Clin Pharm Ther. 2017 Jun;42(3):345-349. doi: 10.1111/jcpt.12505. Epub 2017 Feb 28.
Ref 5	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 6	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 10	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map