m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00205)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CCNA2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by FTO | ||
| Cell Line | Cerebral cortex | Mus musculus |
|
Treatment: METTL3 (f/f, Emx1-cre) cerebral cortex
Control: Wild type cerebral cortex
|
GSE154992 | |
| Regulation |
  |
logFC: 7.89E-01 p-value: 6.22E-11 |
| More Results | Click to View More RNA-seq Results | |
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A-dependent Cyclin-A2 (CCNA2) and CDK2 expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Responsed Drug | Epigallocatechin gallate | Phase 3 | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | FTO knockdown markedly decreased the expression of Cyclin-A2 (CCNA2) and CDK2, crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity. | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| Arrest cell cycle at S phase | ||||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
YTH domain-containing family protein 2 (YTHDF2) [READER]
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A-dependent Cyclin-A2 (CCNA2) and CDK2 expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Responsed Drug | Epigallocatechin gallate | Phase 3 | ||
| Cell Process | Adipogenesis | |||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | FTO knockdown markedly decreased the expression of Cyclin-A2 (CCNA2) and CDK2, crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| Arrest cell cycle at S phase | ||||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
Obesity [ICD-11: 5B81]
| In total 4 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A-dependent Cyclin-A2 (CCNA2) and CDK2 expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition. | |||
| Responsed Disease | Obesity [ICD-11: 5B81] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Epigallocatechin gallate | Phase 3 | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
| Experiment 2 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | FTO knockdown markedly decreased the expression of Cyclin-A2 (CCNA2) and CDK2, crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity. | |||
| Responsed Disease | Obesity [ICD-11: 5B81] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| Arrest cell cycle at S phase | ||||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
| Experiment 3 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A-dependent Cyclin-A2 (CCNA2) and CDK2 expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition. | |||
| Responsed Disease | Obesity [ICD-11: 5B81] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | Epigallocatechin gallate | Phase 3 | ||
| Cell Process | Adipogenesis | |||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
| Experiment 4 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | FTO knockdown markedly decreased the expression of Cyclin-A2 (CCNA2) and CDK2, crucial cell cycle regulators, leading to delayed entry of MDI-induced cells into G2 phase. m6A-binding protein YTHDF2 recognized and decayed methylated mRNAs of CCNA2 and CDK2, leading to decreased protein expression, thereby prolonging cell cycle progression and suppressing adipogenesis. The adipocyte life cycle, including proliferation and adipogenesis, has become a potential target for many bioactive compounds and drugs for the prevention and treatment of obesity. | |||
| Responsed Disease | Obesity [ICD-11: 5B81] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| Arrest cell cycle at S phase | ||||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
Epigallocatechin gallate
[Phase 3]
| In total 2 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | m6A-dependent Cyclin-A2 (CCNA2) and CDK2 expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition. | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Pathway Response | Cell cycle | hsa04110 | ||
| Cell Process | Adipogenesis | |||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
| Experiment 2 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | m6A-dependent Cyclin-A2 (CCNA2) and CDK2 expressions mediated by FTO and YTHDF2 contributed to EGCG-induced adipogenesis inhibition. | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Obesity | ICD-11: 5B81 | ||
| Cell Process | Adipogenesis | |||
| In-vitro Model | 3T3-L1 | Normal | Mus musculus | CVCL_0123 |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00205)
| In total 61 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE067311 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816462-121816463:- | [8] | |
| Sequence | TATGTATACATTTGAAATAAACCAGAAATTTGTTACCTTAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649259 | ||
| mod ID: M6ASITE067312 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816475-121816476:- | [9] | |
| Sequence | TAAGTGTTGAGTATATGTATACATTTGAAATAAACCAGAAA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649260 | ||
| mod ID: M6ASITE067313 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816502-121816503:- | [8] | |
| Sequence | AGAGTAAAACCAGAGAGCAAACCTCTATAAGTGTTGAGTAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649261 | ||
| mod ID: M6ASITE067314 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816514-121816515:- | [8] | |
| Sequence | TGTGGCAAGATGAGAGTAAAACCAGAGAGCAAACCTCTATA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649262 | ||
| mod ID: M6ASITE067315 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816581-121816582:- | [8] | |
| Sequence | CAAGGTAAAAAAATCACAGAACAGATGGATCTCTAATGAAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649263 | ||
| mod ID: M6ASITE067316 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816602-121816603:- | [9] | |
| Sequence | GGTCCTAATTTTTATAAATCACAAGGTAAAAAAATCACAGA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649264 | ||
| mod ID: M6ASITE067317 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816655-121816656:- | [8] | |
| Sequence | ATGTGTCAGCTATGAGTAAGACTGGCATCCAAGAAGTTTAT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649265 | ||
| mod ID: M6ASITE067318 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816744-121816745:- | [10] | |
| Sequence | ATAAAGCAAAGTAAGAATTTACTAAGAGTATGTTAAGTTTT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649266 | ||
| mod ID: M6ASITE067319 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816865-121816866:- | [10] | |
| Sequence | GTTATATATACAGATATACAACTGTTAGCTTTAATTGGCAG | ||
| Motif Score | 2.595904762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649269 | ||
| mod ID: M6ASITE067320 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816868-121816869:- | [9] | |
| Sequence | ATAGTTATATATACAGATATACAACTGTTAGCTTTAATTGG | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649270 | ||
| mod ID: M6ASITE067321 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816976-121816977:- | [8] | |
| Sequence | AAGCACATTAAAAACAAAAAACTATTTTTAAAATCCTGCTA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649274 | ||
| mod ID: M6ASITE067322 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816983-121816984:- | [8] | |
| Sequence | TATTTTAAAGCACATTAAAAACAAAAAACTATTTTTAAAAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; Huh7 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649275 | ||
| mod ID: M6ASITE067323 | Click to Show/Hide the Full List | ||
| mod site | chr4:121816992-121816993:- | [10] | |
| Sequence | AAGGTTTATTATTTTAAAGCACATTAAAAACAAAAAACTAT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649276 | ||
| mod ID: M6ASITE067324 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817028-121817029:- | [10] | |
| Sequence | GCTTATATGCAAATTAACAGACGAGAAATGCTCCAGAAGGT | ||
| Motif Score | 2.871321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649278 | ||
| mod ID: M6ASITE067325 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817032-121817033:- | [10] | |
| Sequence | GGAAGCTTATATGCAAATTAACAGACGAGAAATGCTCCAGA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649279 | ||
| mod ID: M6ASITE067326 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817083-121817084:- | [8] | |
| Sequence | GTTTAGGTTTTGCGAGGTAAACTCAACAGAGGTTGGGAGTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649280 | ||
| mod ID: M6ASITE067327 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817111-121817112:- | [8] | |
| Sequence | ACTTTTTCGCTCTTTGTAAAACCTGTTTGTTTAGGTTTTGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649281 | ||
| mod ID: M6ASITE067328 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817131-121817132:- | [8] | |
| Sequence | ATACAGTAGAGATTCCCCAGACTTTTTCGCTCTTTGTAAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649282 | ||
| mod ID: M6ASITE067329 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817149-121817150:- | [10] | |
| Sequence | TACAGTATTCAGAGATAGATACAGTAGAGATTCCCCAGACT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649283 | ||
| mod ID: M6ASITE067330 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817168-121817169:- | [10] | |
| Sequence | TAATCTAAGCATATCTGAATACAGTATTCAGAGATAGATAC | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649284 | ||
| mod ID: M6ASITE067331 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817202-121817203:- | [10] | |
| Sequence | GCAACTGGATCAATTTGCTGACTTGGGCATAATCTAATCTA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649285 | ||
| mod ID: M6ASITE067332 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817238-121817239:- | [10] | |
| Sequence | AAACAGACCCTCAAATTCTGACATTCATTTTCCTAAGCAAC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649286 | ||
| mod ID: M6ASITE067333 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817256-121817257:- | [8] | |
| Sequence | ATTAAAGTAGGTTTAGGAAAACAGACCCTCAAATTCTGACA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649287 | ||
| mod ID: M6ASITE067334 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817500-121817501:- | [10] | |
| Sequence | TACAAATTATGGTATCTATTACTTTTTAAATGGTTTTAATT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649288 | ||
| mod ID: M6ASITE067335 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817519-121817520:- | [9] | |
| Sequence | TACAGAAGTTGTGGCCAAGTACAAATTATGGTATCTATTAC | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649289 | ||
| mod ID: M6ASITE067336 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817554-121817555:- | [10] | |
| Sequence | TTAACTTAGGTTTTAATTTTACAATCATTTCTGAATACAGA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649290 | ||
| mod ID: M6ASITE067337 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817627-121817628:- | [8] | |
| Sequence | TAAATCTGTAACAATGAAAGACTGCCTTTGTTTTCTAAGAT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649291 | ||
| mod ID: M6ASITE067338 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817637-121817638:- | [9] | |
| Sequence | CCAGAGACACTAAATCTGTAACAATGAAAGACTGCCTTTGT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649292 | ||
| mod ID: M6ASITE067339 | Click to Show/Hide the Full List | ||
| mod site | chr4:121817651-121817652:- | [8] | |
| Sequence | CTCTCCTCAACCCACCAGAGACACTAAATCTGTAACAATGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649293 | ||
| mod ID: M6ASITE067340 | Click to Show/Hide the Full List | ||
| mod site | chr4:121818055-121818056:- | [9] | |
| Sequence | ACAGTCAATAAGAGAAAAGTACAAAAATTCAAAGTAAGAAT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649294 | ||
| mod ID: M6ASITE067341 | Click to Show/Hide the Full List | ||
| mod site | chr4:121818104-121818105:- | [8] | |
| Sequence | GTCTCATGGACCTTCACCAGACCTACCTCAAAGCACCACAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649295 | ||
| mod ID: M6ASITE067342 | Click to Show/Hide the Full List | ||
| mod site | chr4:121818115-121818116:- | [8] | |
| Sequence | TCTTAAGCCTTGTCTCATGGACCTTCACCAGACCTACCTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649296 | ||
| mod ID: M6ASITE067343 | Click to Show/Hide the Full List | ||
| mod site | chr4:121818155-121818156:- | [8] | |
| Sequence | CTGAATCATTAATACGAAAGACTGGATATACCCTGGAAAGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649297 | ||
| mod ID: M6ASITE067344 | Click to Show/Hide the Full List | ||
| mod site | chr4:121818808-121818809:- | [8] | |
| Sequence | GCACTCTACACAGTCACGGGACAAAGCTGGGTATGTATTAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649298 | ||
| mod ID: M6ASITE067345 | Click to Show/Hide the Full List | ||
| mod site | chr4:121818821-121818822:- | [9] | |
| Sequence | TGCCTTTCATTTAGCACTCTACACAGTCACGGGACAAAGCT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649299 | ||
| mod ID: M6ASITE067347 | Click to Show/Hide the Full List | ||
| mod site | chr4:121819396-121819397:- | [8] | |
| Sequence | TCTGCATCAGCAGCCTGCAAACTGCAAAGTTGAAAGTTTAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649300 | ||
| mod ID: M6ASITE067348 | Click to Show/Hide the Full List | ||
| mod site | chr4:121819445-121819446:- | [11] | |
| Sequence | CTTTTGACTTAGCTGCTCCAACAGTAAATCAGTTTCTTACC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649301 | ||
| mod ID: M6ASITE067349 | Click to Show/Hide the Full List | ||
| mod site | chr4:121819506-121819507:- | [8] | |
| Sequence | GATGATACCTACACCAAGAAACAAGTTCTGAGAATGGAGCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649302 | ||
| mod ID: M6ASITE067350 | Click to Show/Hide the Full List | ||
| mod site | chr4:121819534-121819535:- | [9] | |
| Sequence | AGAAGTAGCAGAGTTTGTGTACATTACAGATGATACCTACA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649303 | ||
| mod ID: M6ASITE067351 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820579-121820580:- | [8] | |
| Sequence | ATGTCAGTGCTGAGAGGAAAACTTCAGCTTGTGGGCACTGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649304 | ||
| mod ID: M6ASITE067352 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820622-121820623:- | [9] | |
| Sequence | CCTGCATTTGGCTGTGAACTACATTGATAGGTTCCTGTCTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649305 | ||
| mod ID: M6ASITE067353 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820625-121820626:- | [8] | |
| Sequence | GACCCTGCATTTGGCTGTGAACTACATTGATAGGTTCCTGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649306 | ||
| mod ID: M6ASITE067354 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820644-121820645:- | [8] | |
| Sequence | AATATAAACTACAGAATGAGACCCTGCATTTGGCTGTGAAC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649307 | ||
| mod ID: M6ASITE067355 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820657-121820658:- | [8] | |
| Sequence | GAAGTAGGAGAAGAATATAAACTACAGAATGAGACCCTGCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649308 | ||
| mod ID: M6ASITE067356 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820688-121820689:- | [8] | |
| Sequence | TATGAGAGCTATCCTCGTGGACTGGTTAGTTGAAGTAGGAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649309 | ||
| mod ID: M6ASITE067357 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820721-121820722:- | [8] | |
| Sequence | TTACATGAAGAAACAGCCAGACATCACTAACAGTATGAGAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649310 | ||
| mod ID: M6ASITE067358 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820729-121820730:- | [8] | |
| Sequence | AAAGTGGGTTACATGAAGAAACAGCCAGACATCACTAACAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649311 | ||
| mod ID: M6ASITE067359 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820739-121820740:- | [9] | |
| Sequence | ATGTAAACCTAAAGTGGGTTACATGAAGAAACAGCCAGACA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649312 | ||
| mod ID: M6ASITE067360 | Click to Show/Hide the Full List | ||
| mod site | chr4:121820753-121820754:- | [8] | |
| Sequence | TCTCAATAGGTTAAATGTAAACCTAAAGTGGGTTACATGAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649313 | ||
| mod ID: M6ASITE067361 | Click to Show/Hide the Full List | ||
| mod site | chr4:121821000-121821001:- | [9] | |
| Sequence | AGACTACCATGAGGATATTCACACATACCTTAGGGAAATGG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649314 | ||
| mod ID: M6ASITE067362 | Click to Show/Hide the Full List | ||
| mod site | chr4:121821018-121821019:- | [8] | |
| Sequence | GAGTGTTAATGAAGTACCAGACTACCATGAGGATATTCACA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649315 | ||
| mod ID: M6ASITE067363 | Click to Show/Hide the Full List | ||
| mod site | chr4:121821072-121821073:- | [8] | |
| Sequence | AGAGTCACCACATACTATGGACATGTCAATTATATTAGAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649316 | ||
| mod ID: M6ASITE067364 | Click to Show/Hide the Full List | ||
| mod site | chr4:121821083-121821084:- | [9] | |
| Sequence | TGAATTGTCCCAGAGTCACCACATACTATGGACATGTCAAT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649317 | ||
| mod ID: M6ASITE067365 | Click to Show/Hide the Full List | ||
| mod site | chr4:121822442-121822443:- | [8] | |
| Sequence | AGTTTACCTGGACCCAGAAAACCATTGGTCCCTCTTGATTA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649318 | ||
| mod ID: M6ASITE067366 | Click to Show/Hide the Full List | ||
| mod site | chr4:121822451-121822452:- | [8] | |
| Sequence | TCAGCCATTAGTTTACCTGGACCCAGAAAACCATTGGTCCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000274026.10; ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649319 | ||
| mod ID: M6ASITE067367 | Click to Show/Hide the Full List | ||
| mod site | chr4:121823458-121823459:- | [8] | |
| Sequence | GGCGGTACTGAAGTCCGGGAACCCGCGGGGTCTAGCGCAGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649320 | ||
| mod ID: M6ASITE067368 | Click to Show/Hide the Full List | ||
| mod site | chr4:121823492-121823493:- | [8] | |
| Sequence | CGCCCGTCCAACAACCGCGGACCCGGGCCGCGCTGGCGGTA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649321 | ||
| mod ID: M6ASITE067369 | Click to Show/Hide the Full List | ||
| mod site | chr4:121823502-121823503:- | [9] | |
| Sequence | GAAAAGGCAGCGCCCGTCCAACAACCGCGGACCCGGGCCGC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649322 | ||
| mod ID: M6ASITE067370 | Click to Show/Hide the Full List | ||
| mod site | chr4:121823542-121823543:- | [8] | |
| Sequence | GCAGACGGCGCTCCAAGAGGACCAGGAGAATATCAACCCGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1; ENST00000274026.10 | ||
| External Link | RMBase: m6A_site_649323 | ||
| mod ID: M6ASITE067371 | Click to Show/Hide the Full List | ||
| mod site | chr4:121823896-121823897:- | [8] | |
| Sequence | GGGATACTTGAACTGCAAGAACAGCCGCCGCTCCGGCGGGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293T; HEK293A-TOA; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649324 | ||
| mod ID: M6ASITE067372 | Click to Show/Hide the Full List | ||
| mod site | chr4:121823905-121823906:- | [8] | |
| Sequence | AATAGTCGCGGGATACTTGAACTGCAAGAACAGCCGCCGCT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000618014.1 | ||
| External Link | RMBase: m6A_site_649325 | ||
References