General Information of the m6A Target Gene (ID: M6ATAR00203)
Target Name Caspase-3 (CASP3)
Synonyms
CASP-3; Apopain; Cysteine protease CPP32; CPP-32; Protein Yama; SREBP cleavage activity 1; SCA-1; CPP32
    Click to Show/Hide
Gene Name CASP3
Chromosomal Location 4q35.1
Family peptidase C14A family
Function
Involved in the activation cascade of caspases responsible for apoptosis execution. At the onset of apoptosis it proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp-|-Gly-217' bond. Cleaves and activates sterol regulatory element binding proteins (SREBPs) between the basic helix-loop-helix leucine zipper domain and the membrane attachment domain. Cleaves and activates caspase-6, -7 and -9. Involved in the cleavage of huntingtin. Triggers cell adhesion in sympathetic neurons through RET cleavage. Cleaves and inhibits serine/threonine-protein kinase AKT1 in response to oxidative stress. Acts as an inhibitor of type I interferon production during virus-induced apoptosis by mediating cleavage of antiviral proteins CGAS, IRF3 and MAVS, thereby preventing cytokine overproduction. Cleaves XRCC4 and phospholipid scramblase proteins XKR4, XKR8 and XKR9, leading to promote phosphatidylserine exposure on apoptotic cell surface.
    Click to Show/Hide
Gene ID 836
Uniprot ID
CASP3_HUMAN
HGNC ID
HGNC:1504
KEGG ID
hsa:836
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CASP3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line Embryonic stem cells Mus musculus
Treatment: METTL14 knockout mESCs
Control: Wild type mESCs
GSE156481
Regulation
logFC: -6.38E-01
p-value: 2.86E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL14 can promote osteosarcoma cell apoptosis, inhibit cell viability, and have a tumor suppressor effect on osteosarcoma. METTL14 finally achieves apoptosis by activating Caspase-3 (CASP3).
Target Regulation Up regulation
Responsed Disease Osteosarcoma ICD-11: 2B51
Pathway Response Apoptosis hsa04210
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model 143B Osteosarcoma Homo sapiens CVCL_2270
U2OS Osteosarcoma Homo sapiens CVCL_0042
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line mouse embryonic stem cells Mus musculus
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
GSE145309
Regulation
logFC: -7.30E-01
p-value: 2.00E-53
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 (CASP3) in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and Cyclin D1.
Target Regulation Down regulation
Responsed Disease Gastric cancer ICD-11: 2B72
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
Osteosarcoma [ICD-11: 2B51]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL14 can promote osteosarcoma cell apoptosis, inhibit cell viability, and have a tumor suppressor effect on osteosarcoma. METTL14 finally achieves apoptosis by activating Caspase-3 (CASP3).
Responsed Disease Osteosarcoma [ICD-11: 2B51]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
Target Regulation Up regulation
Pathway Response Apoptosis hsa04210
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model 143B Osteosarcoma Homo sapiens CVCL_2270
U2OS Osteosarcoma Homo sapiens CVCL_0042
Gastric cancer [ICD-11: 2B72]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 (CASP3) in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and Cyclin D1.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response Apoptosis hsa04210
PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03636
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00203)
Caspase-3 (CASP3)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000643 Click to Show/Hide the Full List
mod site chr4:184631335-184631336:- [6]
Sequence TGTTAGCCAGGATGGTCTCGATCTCCTGACCTCAAGTCATC
Transcript ID List ENST00000517513.5; ENST00000308394.9; ENST00000393588.8; ENST00000523916.5; ENST00000393585.6
External Link RMBase: RNA-editing_site_107533
mod ID: A2ISITE000644 Click to Show/Hide the Full List
mod site chr4:184649398-184649399:- [7]
Sequence TGCTATTGTGAGGCGGTTGTAGAAGGTATGAGGAGGCTGTG
Transcript ID List ENST00000523916.5; ENST00000393588.8; ENST00000308394.9; ENST00000517513.5; ENST00000447121.2
External Link RMBase: RNA-editing_site_107534
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003356 Click to Show/Hide the Full List
mod site chr4:184628275-184628276:-
Sequence AGGCAGAGCCATGGACCACGCAGGAAGGGCCTACAGCCCAT
Cell/Tissue List muscle
Seq Type List Bisulfite-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m5C_site_34508
mod ID: M5CSITE003357 Click to Show/Hide the Full List
mod site chr4:184628999-184629000:-
Sequence TTTACAGCTTTCATGATTAGCAAGTTACAGTGATGCTGTGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000393585.6; ENST00000308394.9; ENST00000523916.5
External Link RMBase: m5C_site_34509
N6-methyladenosine (m6A)
In total 42 m6A sequence/site(s) in this target gene
mod ID: M6ASITE068626 Click to Show/Hide the Full List
mod site chr4:184627801-184627802:- [8]
Sequence GACCTGTAACTTTTGTAAATACACATAGCATGTAATGGTAT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000393585.6; ENST00000523916.5; ENST00000308394.9
External Link RMBase: m6A_site_658321
mod ID: M6ASITE068627 Click to Show/Hide the Full List
mod site chr4:184627825-184627826:- [9]
Sequence ATGACAGTTTCTTTTTTCTTACTAGACCTGTAACTTTTGTA
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658322
mod ID: M6ASITE068628 Click to Show/Hide the Full List
mod site chr4:184627842-184627843:- [9]
Sequence TGAGCTCGCATTTGTCAATGACAGTTTCTTTTTTCTTACTA
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000523916.5; ENST00000308394.9; ENST00000393585.6
External Link RMBase: m6A_site_658323
mod ID: M6ASITE068629 Click to Show/Hide the Full List
mod site chr4:184627896-184627897:- [8]
Sequence TCTCACTGGCTGTCAGTATGACATTTCACGGGAGATTTCTT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000393585.6; ENST00000308394.9; ENST00000523916.5
External Link RMBase: m6A_site_658324
mod ID: M6ASITE068630 Click to Show/Hide the Full List
mod site chr4:184627912-184627913:- [9]
Sequence CCGTCACTGCACCAAGTCTCACTGGCTGTCAGTATGACATT
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000393585.6; ENST00000523916.5; ENST00000308394.9
External Link RMBase: m6A_site_658325
mod ID: M6ASITE068631 Click to Show/Hide the Full List
mod site chr4:184628012-184628013:- [10]
Sequence AAGACCTATGAGCACATAGGACTCTAGACGGCATCCAGCCG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000523916.5; ENST00000308394.9; ENST00000393585.6
External Link RMBase: m6A_site_658326
mod ID: M6ASITE068632 Click to Show/Hide the Full List
mod site chr4:184628019-184628020:- [8]
Sequence AAAGAAAAAGACCTATGAGCACATAGGACTCTAGACGGCAT
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658327
mod ID: M6ASITE068633 Click to Show/Hide the Full List
mod site chr4:184628029-184628030:- [10]
Sequence CTGTTTACTGAAAGAAAAAGACCTATGAGCACATAGGACTC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658328
mod ID: M6ASITE068634 Click to Show/Hide the Full List
mod site chr4:184628043-184628044:- [9]
Sequence AGTAATGTTTTATACTGTTTACTGAAAGAAAAAGACCTATG
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658329
mod ID: M6ASITE068635 Click to Show/Hide the Full List
mod site chr4:184628079-184628080:- [9]
Sequence GTTATTTTCTGTTGAAGTTTACAATCAAAGGAAAATAGTAA
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000393585.6; ENST00000308394.9; ENST00000523916.5
External Link RMBase: m6A_site_658330
mod ID: M6ASITE068636 Click to Show/Hide the Full List
mod site chr4:184628318-184628319:- [8]
Sequence TGGTTTGAGCCTGAGCAGAGACATGACTCAGCCTGTTCCAT
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658331
mod ID: M6ASITE068637 Click to Show/Hide the Full List
mod site chr4:184628400-184628401:- [10]
Sequence AAATACAACTTAAATAATAAACAGTGGAATATAAGGAAAGC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000393585.6; ENST00000523916.5; ENST00000308394.9
External Link RMBase: m6A_site_658332
mod ID: M6ASITE068638 Click to Show/Hide the Full List
mod site chr4:184628428-184628429:- [10]
Sequence TGTGAATAAATTCTATAGGAACATATGAAAATACAACTTAA
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658333
mod ID: M6ASITE068639 Click to Show/Hide the Full List
mod site chr4:184628471-184628472:- [10]
Sequence CTATTATATAAAAACCCCAAACTGTTGATTATTAGCCAGGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658334
mod ID: M6ASITE068640 Click to Show/Hide the Full List
mod site chr4:184628478-184628479:- [10]
Sequence TGAAGAGCTATTATATAAAAACCCCAAACTGTTGATTATTA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000308394.9; ENST00000523916.5; ENST00000393585.6
External Link RMBase: m6A_site_658335
mod ID: M6ASITE068641 Click to Show/Hide the Full List
mod site chr4:184628583-184628584:- [9]
Sequence AGTTTTAACTGTAAGGTGCTACAATGCCCCTGGATCTACCA
Motif Score 2.078666667
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658336
mod ID: M6ASITE068642 Click to Show/Hide the Full List
mod site chr4:184628621-184628622:- [8]
Sequence ACTTTTAAGGCTAAAACTTAACATTCATAGAGGGGTGGAGT
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658337
mod ID: M6ASITE068643 Click to Show/Hide the Full List
mod site chr4:184628626-184628627:- [9]
Sequence ACTTGACTTTTAAGGCTAAAACTTAACATTCATAGAGGGGT
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658338
mod ID: M6ASITE068644 Click to Show/Hide the Full List
mod site chr4:184628641-184628642:- [9]
Sequence AGTGTGAGCAAACTAACTTGACTTTTAAGGCTAAAACTTAA
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658339
mod ID: M6ASITE068645 Click to Show/Hide the Full List
mod site chr4:184628650-184628651:- [9]
Sequence GTGAGAGAAAGTGTGAGCAAACTAACTTGACTTTTAAGGCT
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658340
mod ID: M6ASITE068646 Click to Show/Hide the Full List
mod site chr4:184628683-184628684:- [9]
Sequence TGTTTAATATTGAGAAAGAAACTAATATTTTATGTGAGAGA
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000523916.5; ENST00000308394.9; ENST00000393585.6
External Link RMBase: m6A_site_658341
mod ID: M6ASITE068647 Click to Show/Hide the Full List
mod site chr4:184628732-184628733:- [8]
Sequence TTTTGTGATGTTTGTCCTGAACACTTTTGTTGTAAAAAAAT
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658342
mod ID: M6ASITE068648 Click to Show/Hide the Full List
mod site chr4:184628798-184628799:- [9]
Sequence TTATTTTAGAATTGATATACACGGATGACTTAACTGCATTT
Motif Score 2.058863095
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000523916.5; ENST00000393585.6; ENST00000308394.9
External Link RMBase: m6A_site_658343
mod ID: M6ASITE068649 Click to Show/Hide the Full List
mod site chr4:184628800-184628801:- [8]
Sequence CTTTATTTTAGAATTGATATACACGGATGACTTAACTGCAT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000523916.5; ENST00000308394.9; ENST00000393585.6
External Link RMBase: m6A_site_658344
mod ID: M6ASITE068650 Click to Show/Hide the Full List
mod site chr4:184628856-184628857:- [9]
Sequence AGAAATGATGATGTGGAAGAACTTAGGCATCTGTGGGCATG
Motif Score 3.373380952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000308394.9; ENST00000523916.5; ENST00000393585.6
External Link RMBase: m6A_site_658345
mod ID: M6ASITE068651 Click to Show/Hide the Full List
mod site chr4:184628881-184628882:- [9]
Sequence GTGTATTCTAGTTTTGTCAAACTGTAGAAATGATGATGTGG
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658346
mod ID: M6ASITE068652 Click to Show/Hide the Full List
mod site chr4:184628946-184628947:- [9]
Sequence AGTAATTGTGAAAAAGTTAAACATTGAAGTAATGAATTTTT
Motif Score 2.20572619
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000393585.6; ENST00000523916.5; ENST00000308394.9
External Link RMBase: m6A_site_658347
mod ID: M6ASITE068653 Click to Show/Hide the Full List
mod site chr4:184629055-184629056:- [9]
Sequence AGGAATAAATAAAAATGGATACTGGTGCAGTCATTATGAGA
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000523916.5; ENST00000308394.9; ENST00000393585.6
External Link RMBase: m6A_site_658348
mod ID: M6ASITE068654 Click to Show/Hide the Full List
mod site chr4:184629153-184629154:- [9]
Sequence GCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATA
Motif Score 2.897386905
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000523916.5
External Link RMBase: m6A_site_658349
mod ID: M6ASITE068655 Click to Show/Hide the Full List
mod site chr4:184629289-184629290:- [11]
Sequence GTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAAAG
Motif Score 3.373380952
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000523916.5; ENST00000308394.9; ENST00000393585.6; ENST00000517513.5
External Link RMBase: m6A_site_658350
mod ID: M6ASITE068656 Click to Show/Hide the Full List
mod site chr4:184629297-184629298:- [9]
Sequence CATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTAT
Motif Score 2.047297619
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000308394.9; ENST00000393585.6; ENST00000517513.5; ENST00000523916.5
External Link RMBase: m6A_site_658351
mod ID: M6ASITE068657 Click to Show/Hide the Full List
mod site chr4:184629404-184629405:- [9]
Sequence CGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACC
Motif Score 2.830589286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000517513.5; ENST00000308394.9; ENST00000523916.5; ENST00000393588.8; ENST00000393585.6
External Link RMBase: m6A_site_658352
mod ID: M6ASITE068658 Click to Show/Hide the Full List
mod site chr4:184631098-184631099:- [8]
Sequence AGACAGTGGTGTTGATGATGACATGGCGTGTCATAAAATAC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000517513.5; ENST00000523916.5; ENST00000308394.9; ENST00000393585.6; ENST00000393588.8
External Link RMBase: m6A_site_658353
mod ID: M6ASITE068659 Click to Show/Hide the Full List
mod site chr4:184631829-184631830:- [8]
Sequence CTGTTGACCTGAAAAAAATAACAAACTTTTTCAGAGGGGAT
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000393588.8; ENST00000393585.6; ENST00000517513.5; ENST00000308394.9; ENST00000523916.5
External Link RMBase: m6A_site_658354
mod ID: M6ASITE068660 Click to Show/Hide the Full List
mod site chr4:184631859-184631860:- [9]
Sequence AAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTG
Motif Score 2.951386905
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000393588.8; ENST00000523916.5; ENST00000393585.6; ENST00000308394.9; ENST00000517513.5
External Link RMBase: m6A_site_658355
mod ID: M6ASITE068661 Click to Show/Hide the Full List
mod site chr4:184632300-184632301:- [8]
Sequence TCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000393588.8; ENST00000517513.5; ENST00000308394.9; ENST00000523916.5; ENST00000393585.6; ENST00000447121.2
External Link RMBase: m6A_site_658356
mod ID: M6ASITE068662 Click to Show/Hide the Full List
mod site chr4:184632390-184632391:- [8]
Sequence TCTTTCTGTTCCAAGGAATGACATCTCGGTCTGGTACAGAT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000447121.2; ENST00000308394.9; ENST00000393585.6; ENST00000517513.5; ENST00000523916.5; ENST00000393588.8
External Link RMBase: m6A_site_658357
mod ID: M6ASITE068663 Click to Show/Hide the Full List
mod site chr4:184635370-184635371:- [12]
Sequence GGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGATT
Motif Score 3.643047619
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000517513.5; ENST00000308394.9; ENST00000447121.2; ENST00000393588.8; ENST00000523916.5; ENST00000393585.6
External Link RMBase: m6A_site_658358
mod ID: M6ASITE068664 Click to Show/Hide the Full List
mod site chr4:184635388-184635389:- [9]
Sequence ACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACA
Motif Score 4.065041667
Cell/Tissue List HEK293T; iSLK
Seq Type List DART-seq; MeRIP-seq
Transcript ID List ENST00000447121.2; ENST00000393585.6; ENST00000308394.9; ENST00000517513.5; ENST00000523916.5; ENST00000393588.8
External Link RMBase: m6A_site_658359
mod ID: M6ASITE068665 Click to Show/Hide the Full List
mod site chr4:184638402-184638403:- [13]
Sequence AAATCCATTAAAAATTTGGAACCGTGAGTATTTAAATTGAA
Motif Score 2.930744048
Cell/Tissue List fibroblasts; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000393588.8; ENST00000523916.5; ENST00000308394.9; ENST00000517513.5; ENST00000447121.2; ENST00000393585.6
External Link RMBase: m6A_site_658360
mod ID: M6ASITE068666 Click to Show/Hide the Full List
mod site chr4:184638436-184638437:- [13]
Sequence ATCCATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCA
Motif Score 2.627720238
Cell/Tissue List fibroblasts; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000517513.5; ENST00000447121.2; ENST00000393588.8; ENST00000393585.6; ENST00000308394.9; ENST00000523916.5
External Link RMBase: m6A_site_658361
mod ID: M6ASITE068667 Click to Show/Hide the Full List
mod site chr4:184638445-184638446:- [9]
Sequence AATAAAGGTATCCATGGAGAACACTGAAAACTCAGTGGATT
Motif Score 2.951386905
Cell/Tissue List HEK293T; hESC-HEK293T; fibroblasts; iSLK
Seq Type List DART-seq; MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List ENST00000393585.6; ENST00000393588.8; ENST00000447121.2; ENST00000517513.5; ENST00000308394.9; ENST00000523916.5
External Link RMBase: m6A_site_658362