m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00203)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CASP3
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL14 | ||
| Cell Line | Embryonic stem cells | Mus musculus |
|
Treatment: METTL14 knockout mESCs
Control: Wild type mESCs
|
GSE156481 | |
| Regulation |
![]() ![]() |
logFC: -6.38E-01 p-value: 2.86E-05 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL14 can promote osteosarcoma cell apoptosis, inhibit cell viability, and have a tumor suppressor effect on osteosarcoma. METTL14 finally achieves apoptosis by activating Caspase-3 (CASP3). | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Osteosarcoma | ICD-11: 2B51 | ||
| Pathway Response | Apoptosis | hsa04210 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | 143B | Osteosarcoma | Homo sapiens | CVCL_2270 |
| U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 | |
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | mouse embryonic stem cells | Mus musculus |
|
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
|
GSE145309 | |
| Regulation |
![]() ![]() |
logFC: -7.30E-01 p-value: 2.00E-53 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 (CASP3) in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and Cyclin D1. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Gastric cancer | ICD-11: 2B72 | ||
| Pathway Response | Apoptosis | hsa04210 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | AGS | Gastric adenocarcinoma | Homo sapiens | CVCL_0139 |
| MKN45 | Gastric adenocarcinoma | Homo sapiens | CVCL_0434 | |
Osteosarcoma [ICD-11: 2B51]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL14 can promote osteosarcoma cell apoptosis, inhibit cell viability, and have a tumor suppressor effect on osteosarcoma. METTL14 finally achieves apoptosis by activating Caspase-3 (CASP3). | |||
| Responsed Disease | Osteosarcoma [ICD-11: 2B51] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Apoptosis | hsa04210 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | 143B | Osteosarcoma | Homo sapiens | CVCL_2270 |
| U2OS | Osteosarcoma | Homo sapiens | CVCL_0042 | |
Gastric cancer [ICD-11: 2B72]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 (CASP3) in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors p70S6K and Cyclin D1. | |||
| Responsed Disease | Gastric cancer [ICD-11: 2B72] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | Apoptosis | hsa04210 | ||
| PI3K-Akt signaling pathway | hsa04151 | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | AGS | Gastric adenocarcinoma | Homo sapiens | CVCL_0139 |
| MKN45 | Gastric adenocarcinoma | Homo sapiens | CVCL_0434 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03636 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Regulated Target | Histone H3 lysine 27 trimethylation (H3K27me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Gastric cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00203)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE000643 | Click to Show/Hide the Full List | ||
| mod site | chr4:184631335-184631336:- | [6] | |
| Sequence | TGTTAGCCAGGATGGTCTCGATCTCCTGACCTCAAGTCATC | ||
| Transcript ID List | ENST00000517513.5; ENST00000308394.9; ENST00000393588.8; ENST00000523916.5; ENST00000393585.6 | ||
| External Link | RMBase: RNA-editing_site_107533 | ||
| mod ID: A2ISITE000644 | Click to Show/Hide the Full List | ||
| mod site | chr4:184649398-184649399:- | [7] | |
| Sequence | TGCTATTGTGAGGCGGTTGTAGAAGGTATGAGGAGGCTGTG | ||
| Transcript ID List | ENST00000523916.5; ENST00000393588.8; ENST00000308394.9; ENST00000517513.5; ENST00000447121.2 | ||
| External Link | RMBase: RNA-editing_site_107534 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 42 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE068626 | Click to Show/Hide the Full List | ||
| mod site | chr4:184627801-184627802:- | [8] | |
| Sequence | GACCTGTAACTTTTGTAAATACACATAGCATGTAATGGTAT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000523916.5; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658321 | ||
| mod ID: M6ASITE068627 | Click to Show/Hide the Full List | ||
| mod site | chr4:184627825-184627826:- | [9] | |
| Sequence | ATGACAGTTTCTTTTTTCTTACTAGACCTGTAACTTTTGTA | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658322 | ||
| mod ID: M6ASITE068628 | Click to Show/Hide the Full List | ||
| mod site | chr4:184627842-184627843:- | [9] | |
| Sequence | TGAGCTCGCATTTGTCAATGACAGTTTCTTTTTTCTTACTA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000308394.9; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658323 | ||
| mod ID: M6ASITE068629 | Click to Show/Hide the Full List | ||
| mod site | chr4:184627896-184627897:- | [8] | |
| Sequence | TCTCACTGGCTGTCAGTATGACATTTCACGGGAGATTTCTT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000308394.9; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658324 | ||
| mod ID: M6ASITE068630 | Click to Show/Hide the Full List | ||
| mod site | chr4:184627912-184627913:- | [9] | |
| Sequence | CCGTCACTGCACCAAGTCTCACTGGCTGTCAGTATGACATT | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000523916.5; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658325 | ||
| mod ID: M6ASITE068631 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628012-184628013:- | [10] | |
| Sequence | AAGACCTATGAGCACATAGGACTCTAGACGGCATCCAGCCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000308394.9; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658326 | ||
| mod ID: M6ASITE068632 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628019-184628020:- | [8] | |
| Sequence | AAAGAAAAAGACCTATGAGCACATAGGACTCTAGACGGCAT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658327 | ||
| mod ID: M6ASITE068633 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628029-184628030:- | [10] | |
| Sequence | CTGTTTACTGAAAGAAAAAGACCTATGAGCACATAGGACTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658328 | ||
| mod ID: M6ASITE068634 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628043-184628044:- | [9] | |
| Sequence | AGTAATGTTTTATACTGTTTACTGAAAGAAAAAGACCTATG | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658329 | ||
| mod ID: M6ASITE068635 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628079-184628080:- | [9] | |
| Sequence | GTTATTTTCTGTTGAAGTTTACAATCAAAGGAAAATAGTAA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000308394.9; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658330 | ||
| mod ID: M6ASITE068636 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628318-184628319:- | [8] | |
| Sequence | TGGTTTGAGCCTGAGCAGAGACATGACTCAGCCTGTTCCAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658331 | ||
| mod ID: M6ASITE068637 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628400-184628401:- | [10] | |
| Sequence | AAATACAACTTAAATAATAAACAGTGGAATATAAGGAAAGC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000523916.5; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658332 | ||
| mod ID: M6ASITE068638 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628428-184628429:- | [10] | |
| Sequence | TGTGAATAAATTCTATAGGAACATATGAAAATACAACTTAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658333 | ||
| mod ID: M6ASITE068639 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628471-184628472:- | [10] | |
| Sequence | CTATTATATAAAAACCCCAAACTGTTGATTATTAGCCAGGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658334 | ||
| mod ID: M6ASITE068640 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628478-184628479:- | [10] | |
| Sequence | TGAAGAGCTATTATATAAAAACCCCAAACTGTTGATTATTA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000523916.5; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658335 | ||
| mod ID: M6ASITE068641 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628583-184628584:- | [9] | |
| Sequence | AGTTTTAACTGTAAGGTGCTACAATGCCCCTGGATCTACCA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658336 | ||
| mod ID: M6ASITE068642 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628621-184628622:- | [8] | |
| Sequence | ACTTTTAAGGCTAAAACTTAACATTCATAGAGGGGTGGAGT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658337 | ||
| mod ID: M6ASITE068643 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628626-184628627:- | [9] | |
| Sequence | ACTTGACTTTTAAGGCTAAAACTTAACATTCATAGAGGGGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658338 | ||
| mod ID: M6ASITE068644 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628641-184628642:- | [9] | |
| Sequence | AGTGTGAGCAAACTAACTTGACTTTTAAGGCTAAAACTTAA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658339 | ||
| mod ID: M6ASITE068645 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628650-184628651:- | [9] | |
| Sequence | GTGAGAGAAAGTGTGAGCAAACTAACTTGACTTTTAAGGCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658340 | ||
| mod ID: M6ASITE068646 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628683-184628684:- | [9] | |
| Sequence | TGTTTAATATTGAGAAAGAAACTAATATTTTATGTGAGAGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000308394.9; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658341 | ||
| mod ID: M6ASITE068647 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628732-184628733:- | [8] | |
| Sequence | TTTTGTGATGTTTGTCCTGAACACTTTTGTTGTAAAAAAAT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658342 | ||
| mod ID: M6ASITE068648 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628798-184628799:- | [9] | |
| Sequence | TTATTTTAGAATTGATATACACGGATGACTTAACTGCATTT | ||
| Motif Score | 2.058863095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000393585.6; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658343 | ||
| mod ID: M6ASITE068649 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628800-184628801:- | [8] | |
| Sequence | CTTTATTTTAGAATTGATATACACGGATGACTTAACTGCAT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000308394.9; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658344 | ||
| mod ID: M6ASITE068650 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628856-184628857:- | [9] | |
| Sequence | AGAAATGATGATGTGGAAGAACTTAGGCATCTGTGGGCATG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000523916.5; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658345 | ||
| mod ID: M6ASITE068651 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628881-184628882:- | [9] | |
| Sequence | GTGTATTCTAGTTTTGTCAAACTGTAGAAATGATGATGTGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658346 | ||
| mod ID: M6ASITE068652 | Click to Show/Hide the Full List | ||
| mod site | chr4:184628946-184628947:- | [9] | |
| Sequence | AGTAATTGTGAAAAAGTTAAACATTGAAGTAATGAATTTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000523916.5; ENST00000308394.9 | ||
| External Link | RMBase: m6A_site_658347 | ||
| mod ID: M6ASITE068653 | Click to Show/Hide the Full List | ||
| mod site | chr4:184629055-184629056:- | [9] | |
| Sequence | AGGAATAAATAAAAATGGATACTGGTGCAGTCATTATGAGA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000523916.5; ENST00000308394.9; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658348 | ||
| mod ID: M6ASITE068654 | Click to Show/Hide the Full List | ||
| mod site | chr4:184629153-184629154:- | [9] | |
| Sequence | GCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658349 | ||
| mod ID: M6ASITE068655 | Click to Show/Hide the Full List | ||
| mod site | chr4:184629289-184629290:- | [11] | |
| Sequence | GTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAAAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000523916.5; ENST00000308394.9; ENST00000393585.6; ENST00000517513.5 | ||
| External Link | RMBase: m6A_site_658350 | ||
| mod ID: M6ASITE068656 | Click to Show/Hide the Full List | ||
| mod site | chr4:184629297-184629298:- | [9] | |
| Sequence | CATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000308394.9; ENST00000393585.6; ENST00000517513.5; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658351 | ||
| mod ID: M6ASITE068657 | Click to Show/Hide the Full List | ||
| mod site | chr4:184629404-184629405:- | [9] | |
| Sequence | CGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000517513.5; ENST00000308394.9; ENST00000523916.5; ENST00000393588.8; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658352 | ||
| mod ID: M6ASITE068658 | Click to Show/Hide the Full List | ||
| mod site | chr4:184631098-184631099:- | [8] | |
| Sequence | AGACAGTGGTGTTGATGATGACATGGCGTGTCATAAAATAC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000517513.5; ENST00000523916.5; ENST00000308394.9; ENST00000393585.6; ENST00000393588.8 | ||
| External Link | RMBase: m6A_site_658353 | ||
| mod ID: M6ASITE068659 | Click to Show/Hide the Full List | ||
| mod site | chr4:184631829-184631830:- | [8] | |
| Sequence | CTGTTGACCTGAAAAAAATAACAAACTTTTTCAGAGGGGAT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000393588.8; ENST00000393585.6; ENST00000517513.5; ENST00000308394.9; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658354 | ||
| mod ID: M6ASITE068660 | Click to Show/Hide the Full List | ||
| mod site | chr4:184631859-184631860:- | [9] | |
| Sequence | AAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000393588.8; ENST00000523916.5; ENST00000393585.6; ENST00000308394.9; ENST00000517513.5 | ||
| External Link | RMBase: m6A_site_658355 | ||
| mod ID: M6ASITE068661 | Click to Show/Hide the Full List | ||
| mod site | chr4:184632300-184632301:- | [8] | |
| Sequence | TCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000393588.8; ENST00000517513.5; ENST00000308394.9; ENST00000523916.5; ENST00000393585.6; ENST00000447121.2 | ||
| External Link | RMBase: m6A_site_658356 | ||
| mod ID: M6ASITE068662 | Click to Show/Hide the Full List | ||
| mod site | chr4:184632390-184632391:- | [8] | |
| Sequence | TCTTTCTGTTCCAAGGAATGACATCTCGGTCTGGTACAGAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000447121.2; ENST00000308394.9; ENST00000393585.6; ENST00000517513.5; ENST00000523916.5; ENST00000393588.8 | ||
| External Link | RMBase: m6A_site_658357 | ||
| mod ID: M6ASITE068663 | Click to Show/Hide the Full List | ||
| mod site | chr4:184635370-184635371:- | [12] | |
| Sequence | GGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGATT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000517513.5; ENST00000308394.9; ENST00000447121.2; ENST00000393588.8; ENST00000523916.5; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658358 | ||
| mod ID: M6ASITE068664 | Click to Show/Hide the Full List | ||
| mod site | chr4:184635388-184635389:- | [9] | |
| Sequence | ACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293T; iSLK | ||
| Seq Type List | DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000447121.2; ENST00000393585.6; ENST00000308394.9; ENST00000517513.5; ENST00000523916.5; ENST00000393588.8 | ||
| External Link | RMBase: m6A_site_658359 | ||
| mod ID: M6ASITE068665 | Click to Show/Hide the Full List | ||
| mod site | chr4:184638402-184638403:- | [13] | |
| Sequence | AAATCCATTAAAAATTTGGAACCGTGAGTATTTAAATTGAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393588.8; ENST00000523916.5; ENST00000308394.9; ENST00000517513.5; ENST00000447121.2; ENST00000393585.6 | ||
| External Link | RMBase: m6A_site_658360 | ||
| mod ID: M6ASITE068666 | Click to Show/Hide the Full List | ||
| mod site | chr4:184638436-184638437:- | [13] | |
| Sequence | ATCCATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | fibroblasts; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000517513.5; ENST00000447121.2; ENST00000393588.8; ENST00000393585.6; ENST00000308394.9; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658361 | ||
| mod ID: M6ASITE068667 | Click to Show/Hide the Full List | ||
| mod site | chr4:184638445-184638446:- | [9] | |
| Sequence | AATAAAGGTATCCATGGAGAACACTGAAAACTCAGTGGATT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; fibroblasts; iSLK | ||
| Seq Type List | DART-seq; MAZTER-seq; m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393585.6; ENST00000393588.8; ENST00000447121.2; ENST00000517513.5; ENST00000308394.9; ENST00000523916.5 | ||
| External Link | RMBase: m6A_site_658362 | ||
References



