m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00191)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ATG101
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets ATG7 and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with Autophagy-related protein 101 (ATG101). CircRAB11FIP1 mediated mRNA expression levels of ATG5 and ATG7 depending on m6A. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Malignant mixed epithelial mesenchymal tumour of ovary | ICD-11: 2B5D.0 | ||
| Pathway Response | Autophagy | hsa04140 | ||
| Cell Process | Cell autophagy | |||
| In-vitro Model | SK-OV-3 | Ovarian serous cystadenocarcinoma | Homo sapiens | CVCL_0532 |
| In-vivo Model | The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined. | |||
Malignant mixed epithelial mesenchymal tumour [ICD-11: 2B5D]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets ATG7 and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with Autophagy-related protein 101 (ATG101). CircRAB11FIP1 mediated mRNA expression levels of ATG5 and ATG7 depending on m6A. | |||
| Responsed Disease | Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Autophagy | hsa04140 | ||
| Cell Process | Cell autophagy | |||
| In-vitro Model | SK-OV-3 | Ovarian serous cystadenocarcinoma | Homo sapiens | CVCL_0532 |
| In-vivo Model | The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00191)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE000001 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077108-52077109:+ | [2] | |
| Sequence | CAGCCCTACCTGTACAAGATCTCCTTCCAGATCACTGATGC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m5C_site_10071 | ||
| mod ID: M5CSITE000002 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077110-52077111:+ | [2] | |
| Sequence | GCCCTACCTGTACAAGATCTCCTTCCAGATCACTGATGCCC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m5C_site_10072 | ||
N6-methyladenosine (m6A)
| In total 25 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE012442 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070055-52070056:+ | [3] | |
| Sequence | ATCTGAGAGGCTGGTCGTGGACTGTGGTTGGGGGAGGTGGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; H1B; HEK293A-TOA; iSLK; TREX; MSC; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000547409.1; ENST00000550604.1; ENST00000552544.5; ENST00000552947.1; ENST00000548915.1; ENST00000336854.8; ENST00000553049.5 | ||
| External Link | RMBase: m6A_site_188970 | ||
| mod ID: M6ASITE012443 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070198-52070199:+ | [3] | |
| Sequence | CGCGGGGCGCCGCCCCCGAGACACCCGAGGAGTCCGTTCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; MM6; GSC-11; HEK293T; iSLK; MSC; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000548915.1; ENST00000336854.8; ENST00000550604.1; ENST00000553049.5; ENST00000552947.1; ENST00000552544.5; ENST00000547409.1 | ||
| External Link | RMBase: m6A_site_188971 | ||
| mod ID: M6ASITE012444 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070233-52070234:+ | [4] | |
| Sequence | GTTCCTCCCTGGTTACGTGGACTGTGGAGGTTCGCGCGTAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; HeLa; A549; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000553049.5; ENST00000552544.5; ENST00000547409.1; ENST00000336854.8; ENST00000548915.1; ENST00000550604.1; ENST00000552947.1 | ||
| External Link | RMBase: m6A_site_188972 | ||
| mod ID: M6ASITE012445 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070273-52070274:+ | [4] | |
| Sequence | GTGGCGGCGGGGGATACGGGACCCGGGCGGGAATTCCTTCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; HeLa; A549; GSC-11; HEK293T; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000336854.8; ENST00000552544.5; ENST00000547409.1; ENST00000553049.5; ENST00000550604.1; ENST00000548915.1; ENST00000552947.1 | ||
| External Link | RMBase: m6A_site_188973 | ||
| mod ID: M6ASITE012446 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070469-52070470:+ | [3] | |
| Sequence | TTGAGGAATCCGTGCTCCAAACTCTACACTCAAGGTGGGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000552544.5; ENST00000548915.1; ENST00000550604.1; ENST00000552947.1; ENST00000553049.5; ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_188974 | ||
| mod ID: M6ASITE012447 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070554-52070555:+ | [3] | |
| Sequence | AGCCTCTGCCACTCGGGGGGACAAGAGGGACGAGACTTTCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000553049.5; ENST00000552544.5; ENST00000550604.1; ENST00000336854.8; ENST00000552947.1; ENST00000548915.1 | ||
| External Link | RMBase: m6A_site_188975 | ||
| mod ID: M6ASITE012448 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070568-52070569:+ | [3] | |
| Sequence | GGGGGGACAAGAGGGACGAGACTTTCCAGACCCTACTCTGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000550604.1; ENST00000548915.1; ENST00000336854.8; ENST00000552947.1; ENST00000552544.5; ENST00000553049.5 | ||
| External Link | RMBase: m6A_site_188976 | ||
| mod ID: M6ASITE012449 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070577-52070578:+ | [3] | |
| Sequence | AGAGGGACGAGACTTTCCAGACCCTACTCTGGTGGGCCCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000552544.5; ENST00000548915.1; ENST00000553049.5; ENST00000336854.8; ENST00000550604.1; ENST00000552947.1 | ||
| External Link | RMBase: m6A_site_188977 | ||
| mod ID: M6ASITE012450 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070629-52070630:+ | [3] | |
| Sequence | CTCACTGTGTGGGGCAGGGGACAACAAGGTTTTCACAGACC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000336854.8; ENST00000548915.1; ENST00000553049.5; ENST00000552947.1; ENST00000550604.1; ENST00000552544.5 | ||
| External Link | RMBase: m6A_site_188978 | ||
| mod ID: M6ASITE012451 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070796-52070797:+ | [3] | |
| Sequence | TGTGTGAACGATTGCGGGGGACACAAGAGGGAGAAGTCGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000550604.1; ENST00000552544.5; ENST00000552947.1; ENST00000336854.8; ENST00000548915.1; ENST00000553049.5 | ||
| External Link | RMBase: m6A_site_188979 | ||
| mod ID: M6ASITE012452 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070833-52070834:+ | [3] | |
| Sequence | CGTGGAAGAAAGGGAGCCGGACCAGAGCCGGGAGTCTCTAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000552947.1; ENST00000548915.1; ENST00000550604.1; ENST00000553049.5; ENST00000336854.8; ENST00000552544.5 | ||
| External Link | RMBase: m6A_site_188980 | ||
| mod ID: M6ASITE012453 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070865-52070866:+ | [3] | |
| Sequence | AGTCTCTAGATGGGAAGAAAACTGCTGGATGGAGTAAAACT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000553049.5; ENST00000552947.1; ENST00000550604.1; ENST00000336854.8; ENST00000552544.5; ENST00000548915.1 | ||
| External Link | RMBase: m6A_site_188981 | ||
| mod ID: M6ASITE012454 | Click to Show/Hide the Full List | ||
| mod site | chr12:52070883-52070884:+ | [3] | |
| Sequence | AAACTGCTGGATGGAGTAAAACTGGAGGGCAAAACGAGCAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000548915.1; ENST00000336854.8; ENST00000553049.5; ENST00000552947.1; ENST00000550604.1; ENST00000552544.5 | ||
| External Link | RMBase: m6A_site_188982 | ||
| mod ID: M6ASITE012455 | Click to Show/Hide the Full List | ||
| mod site | chr12:52073654-52073655:+ | [5] | |
| Sequence | GGTTACTGGGTGCAGGATGAACTGTCGCTCGGAGGTGCTGG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; peripheral-blood; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000553049.5; ENST00000336854.8; ENST00000548915.1; ENST00000550604.1; ENST00000552544.5 | ||
| External Link | RMBase: m6A_site_188983 | ||
| mod ID: M6ASITE012456 | Click to Show/Hide the Full List | ||
| mod site | chr12:52073862-52073863:+ | [3] | |
| Sequence | GTGCGTGTCTCTTCTGAGGAACTGGATCGTGCCCTGCGCAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000336854.8; ENST00000550604.1; ENST00000552544.5; ENST00000553049.5; ENST00000548915.1 | ||
| External Link | RMBase: m6A_site_188984 | ||
| mod ID: M6ASITE012457 | Click to Show/Hide the Full List | ||
| mod site | chr12:52076899-52076900:+ | [6] | |
| Sequence | GCATCCCATGGGAAGTGTGGACGGTCAAGGTGCATGTGGTA | ||
| Motif Score | 3.616982143 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000553049.5; ENST00000336854.8; ENST00000548915.1 | ||
| External Link | RMBase: m6A_site_188986 | ||
| mod ID: M6ASITE012458 | Click to Show/Hide the Full List | ||
| mod site | chr12:52076973-52076974:+ | [3] | |
| Sequence | CGGGAGAAGGTGGGTGAGAAACTCTGCGAGAAGATCATCAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; BGC823; U2OS; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000336854.8; ENST00000553049.5 | ||
| External Link | RMBase: m6A_site_188987 | ||
| mod ID: M6ASITE012459 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077068-52077069:+ | [7] | |
| Sequence | GGAGGTGGATAACGTGTTTGACACAGGCTTGCGGGACGTGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000336854.8; ENST00000553049.5 | ||
| External Link | RMBase: m6A_site_188989 | ||
| mod ID: M6ASITE012460 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077101-52077102:+ | [7] | |
| Sequence | GGACGTGCAGCCCTACCTGTACAAGATCTCCTTCCAGATCA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000336854.8; ENST00000553049.5 | ||
| External Link | RMBase: m6A_site_188990 | ||
| mod ID: M6ASITE012461 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077173-52077174:+ | [3] | |
| Sequence | CATGCGCAGGCTCATCAAAGACACCCTTGCCCTCTGAGCGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; kidney; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_188991 | ||
| mod ID: M6ASITE012462 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077229-52077230:+ | [3] | |
| Sequence | AGCTCCTTGATGGCTCCCAGACCTTGGCTTTTGGGAATTGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_188992 | ||
| mod ID: M6ASITE012463 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077250-52077251:+ | [8] | |
| Sequence | CCTTGGCTTTTGGGAATTGCACTTTTGGGCCTTTGGGCTCT | ||
| Motif Score | 3.252583333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_188993 | ||
| mod ID: M6ASITE012464 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077274-52077275:+ | [3] | |
| Sequence | TTGGGCCTTTGGGCTCTGGAACCTGCTCTGGGTCATTGGTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_188994 | ||
| mod ID: M6ASITE012465 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077297-52077298:+ | [3] | |
| Sequence | TGCTCTGGGTCATTGGTGAGACTTGGAAGGGGCAGCCCCCG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_188995 | ||
| mod ID: M6ASITE012467 | Click to Show/Hide the Full List | ||
| mod site | chr12:52077478-52077479:+ | [3] | |
| Sequence | GATGGGGAATAAAGTTGAGAACATGAGTTTGGGCTGAGCCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; Huh7; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000336854.8 | ||
| External Link | RMBase: m6A_site_189001 | ||
References