m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00191)

Target Name	Autophagy-related protein 101 (ATG101)
Synonyms	C12orf44; PP894 Click to Show/Hide
Gene Name	ATG101
Chromosomal Location	12q13.13
Family	ATG101 family
Function	Autophagy factor required for autophagosome formation. Stabilizes ATG13, protecting it from proteasomal degradation. Click to Show/Hide
Gene ID	60673
Uniprot ID	ATGA1_HUMAN
HGNC ID	HGNC:25679
KEGG ID	hsa:60673

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ATG101 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets ATG7 and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with Autophagy-related protein 101 (ATG101). CircRAB11FIP1 mediated mRNA expression levels of ATG5 and ATG7 depending on m6A.
Target Regulation	Up regulation
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary		ICD-11: 2B5D.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell autophagy
In-vitro Model	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined.

Malignant mixed epithelial mesenchymal tumour [ICD-11: 2B5D]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. CircRAB11FIP1 can serve as the possible marker for EOC diagnosis and treatment. CircRAB11FIP1 regulated the mechanism of autophagy through m6A modification and direct binding to mRNA. CircRAB11FIP1 bound to the mRNA of FTO and promoted its expression. CircRAB11FIP1 directly bound to miR-129 and regulated its targets ATG7 and ATG14. CircRAB11FIP1 bound to desmocollin 1to facilitate its interaction with Autophagy-related protein 101 (ATG101). CircRAB11FIP1 mediated mRNA expression levels of ATG5 and ATG7 depending on m6A.
Responsed Disease	Malignant mixed epithelial mesenchymal tumour of ovary [ICD-11: 2B5D.0]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	Cell autophagy
In-vitro Model	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	The SKOV3 ovarian cancer cell line was transfected with LV2-1 or LV2-NC. Thereafter, BALB/c nude mice (6-week old) were intraperitoneally injected with SKOV3 cells. The mice were killed after 5 weeks, and the number of ascites was determined.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00191)

Autophagy-related protein 101 (ATG101)

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000001		Click to Show/Hide the Full List
mod site	chr12:52077108-52077109:+		[2]
Sequence	CAGCCCTACCTGTACAAGATCTCCTTCCAGATCACTGATGC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m5C_site_10071
mod ID: M5CSITE000002		Click to Show/Hide the Full List
mod site	chr12:52077110-52077111:+		[2]
Sequence	GCCCTACCTGTACAAGATCTCCTTCCAGATCACTGATGCCC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m5C_site_10072

N6-methyladenosine (m6A)

In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE012442		Click to Show/Hide the Full List
mod site	chr12:52070055-52070056:+		[3]
Sequence	ATCTGAGAGGCTGGTCGTGGACTGTGGTTGGGGGAGGTGGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; H1B; HEK293A-TOA; iSLK; TREX; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000547409.1; ENST00000550604.1; ENST00000552544.5; ENST00000552947.1; ENST00000548915.1; ENST00000336854.8; ENST00000553049.5
External Link	RMBase: m6A_site_188970
mod ID: M6ASITE012443		Click to Show/Hide the Full List
mod site	chr12:52070198-52070199:+		[3]
Sequence	CGCGGGGCGCCGCCCCCGAGACACCCGAGGAGTCCGTTCCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; MM6; GSC-11; HEK293T; iSLK; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548915.1; ENST00000336854.8; ENST00000550604.1; ENST00000553049.5; ENST00000552947.1; ENST00000552544.5; ENST00000547409.1
External Link	RMBase: m6A_site_188971
mod ID: M6ASITE012444		Click to Show/Hide the Full List
mod site	chr12:52070233-52070234:+		[4]
Sequence	GTTCCTCCCTGGTTACGTGGACTGTGGAGGTTCGCGCGTAG
Motif Score	4.065041667
Cell/Tissue List	HepG2; HeLa; A549; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000553049.5; ENST00000552544.5; ENST00000547409.1; ENST00000336854.8; ENST00000548915.1; ENST00000550604.1; ENST00000552947.1
External Link	RMBase: m6A_site_188972
mod ID: M6ASITE012445		Click to Show/Hide the Full List
mod site	chr12:52070273-52070274:+		[4]
Sequence	GTGGCGGCGGGGGATACGGGACCCGGGCGGGAATTCCTTCC
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; A549; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000336854.8; ENST00000552544.5; ENST00000547409.1; ENST00000553049.5; ENST00000550604.1; ENST00000548915.1; ENST00000552947.1
External Link	RMBase: m6A_site_188973
mod ID: M6ASITE012446		Click to Show/Hide the Full List
mod site	chr12:52070469-52070470:+		[3]
Sequence	TTGAGGAATCCGTGCTCCAAACTCTACACTCAAGGTGGGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000552544.5; ENST00000548915.1; ENST00000550604.1; ENST00000552947.1; ENST00000553049.5; ENST00000336854.8
External Link	RMBase: m6A_site_188974
mod ID: M6ASITE012447		Click to Show/Hide the Full List
mod site	chr12:52070554-52070555:+		[3]
Sequence	AGCCTCTGCCACTCGGGGGGACAAGAGGGACGAGACTTTCC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000553049.5; ENST00000552544.5; ENST00000550604.1; ENST00000336854.8; ENST00000552947.1; ENST00000548915.1
External Link	RMBase: m6A_site_188975
mod ID: M6ASITE012448		Click to Show/Hide the Full List
mod site	chr12:52070568-52070569:+		[3]
Sequence	GGGGGGACAAGAGGGACGAGACTTTCCAGACCCTACTCTGG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000550604.1; ENST00000548915.1; ENST00000336854.8; ENST00000552947.1; ENST00000552544.5; ENST00000553049.5
External Link	RMBase: m6A_site_188976
mod ID: M6ASITE012449		Click to Show/Hide the Full List
mod site	chr12:52070577-52070578:+		[3]
Sequence	AGAGGGACGAGACTTTCCAGACCCTACTCTGGTGGGCCCTG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000552544.5; ENST00000548915.1; ENST00000553049.5; ENST00000336854.8; ENST00000550604.1; ENST00000552947.1
External Link	RMBase: m6A_site_188977
mod ID: M6ASITE012450		Click to Show/Hide the Full List
mod site	chr12:52070629-52070630:+		[3]
Sequence	CTCACTGTGTGGGGCAGGGGACAACAAGGTTTTCACAGACC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000336854.8; ENST00000548915.1; ENST00000553049.5; ENST00000552947.1; ENST00000550604.1; ENST00000552544.5
External Link	RMBase: m6A_site_188978
mod ID: M6ASITE012451		Click to Show/Hide the Full List
mod site	chr12:52070796-52070797:+		[3]
Sequence	TGTGTGAACGATTGCGGGGGACACAAGAGGGAGAAGTCGTG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000550604.1; ENST00000552544.5; ENST00000552947.1; ENST00000336854.8; ENST00000548915.1; ENST00000553049.5
External Link	RMBase: m6A_site_188979
mod ID: M6ASITE012452		Click to Show/Hide the Full List
mod site	chr12:52070833-52070834:+		[3]
Sequence	CGTGGAAGAAAGGGAGCCGGACCAGAGCCGGGAGTCTCTAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000552947.1; ENST00000548915.1; ENST00000550604.1; ENST00000553049.5; ENST00000336854.8; ENST00000552544.5
External Link	RMBase: m6A_site_188980
mod ID: M6ASITE012453		Click to Show/Hide the Full List
mod site	chr12:52070865-52070866:+		[3]
Sequence	AGTCTCTAGATGGGAAGAAAACTGCTGGATGGAGTAAAACT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000553049.5; ENST00000552947.1; ENST00000550604.1; ENST00000336854.8; ENST00000552544.5; ENST00000548915.1
External Link	RMBase: m6A_site_188981
mod ID: M6ASITE012454		Click to Show/Hide the Full List
mod site	chr12:52070883-52070884:+		[3]
Sequence	AAACTGCTGGATGGAGTAAAACTGGAGGGCAAAACGAGCAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000548915.1; ENST00000336854.8; ENST00000553049.5; ENST00000552947.1; ENST00000550604.1; ENST00000552544.5
External Link	RMBase: m6A_site_188982
mod ID: M6ASITE012455		Click to Show/Hide the Full List
mod site	chr12:52073654-52073655:+		[5]
Sequence	GGTTACTGGGTGCAGGATGAACTGTCGCTCGGAGGTGCTGG
Motif Score	3.373380952
Cell/Tissue List	HepG2; peripheral-blood; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000553049.5; ENST00000336854.8; ENST00000548915.1; ENST00000550604.1; ENST00000552544.5
External Link	RMBase: m6A_site_188983
mod ID: M6ASITE012456		Click to Show/Hide the Full List
mod site	chr12:52073862-52073863:+		[3]
Sequence	GTGCGTGTCTCTTCTGAGGAACTGGATCGTGCCCTGCGCAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000336854.8; ENST00000550604.1; ENST00000552544.5; ENST00000553049.5; ENST00000548915.1
External Link	RMBase: m6A_site_188984
mod ID: M6ASITE012457		Click to Show/Hide the Full List
mod site	chr12:52076899-52076900:+		[6]
Sequence	GCATCCCATGGGAAGTGTGGACGGTCAAGGTGCATGTGGTA
Motif Score	3.616982143
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000553049.5; ENST00000336854.8; ENST00000548915.1
External Link	RMBase: m6A_site_188986
mod ID: M6ASITE012458		Click to Show/Hide the Full List
mod site	chr12:52076973-52076974:+		[3]
Sequence	CGGGAGAAGGTGGGTGAGAAACTCTGCGAGAAGATCATCAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; BGC823; U2OS; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000336854.8; ENST00000553049.5
External Link	RMBase: m6A_site_188987
mod ID: M6ASITE012459		Click to Show/Hide the Full List
mod site	chr12:52077068-52077069:+		[7]
Sequence	GGAGGTGGATAACGTGTTTGACACAGGCTTGCGGGACGTGC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000336854.8; ENST00000553049.5
External Link	RMBase: m6A_site_188989
mod ID: M6ASITE012460		Click to Show/Hide the Full List
mod site	chr12:52077101-52077102:+		[7]
Sequence	GGACGTGCAGCCCTACCTGTACAAGATCTCCTTCCAGATCA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000336854.8; ENST00000553049.5
External Link	RMBase: m6A_site_188990
mod ID: M6ASITE012461		Click to Show/Hide the Full List
mod site	chr12:52077173-52077174:+		[3]
Sequence	CATGCGCAGGCTCATCAAAGACACCCTTGCCCTCTGAGCGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; kidney; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m6A_site_188991
mod ID: M6ASITE012462		Click to Show/Hide the Full List
mod site	chr12:52077229-52077230:+		[3]
Sequence	AGCTCCTTGATGGCTCCCAGACCTTGGCTTTTGGGAATTGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m6A_site_188992
mod ID: M6ASITE012463		Click to Show/Hide the Full List
mod site	chr12:52077250-52077251:+		[8]
Sequence	CCTTGGCTTTTGGGAATTGCACTTTTGGGCCTTTGGGCTCT
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m6A_site_188993
mod ID: M6ASITE012464		Click to Show/Hide the Full List
mod site	chr12:52077274-52077275:+		[3]
Sequence	TTGGGCCTTTGGGCTCTGGAACCTGCTCTGGGTCATTGGTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m6A_site_188994
mod ID: M6ASITE012465		Click to Show/Hide the Full List
mod site	chr12:52077297-52077298:+		[3]
Sequence	TGCTCTGGGTCATTGGTGAGACTTGGAAGGGGCAGCCCCCG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m6A_site_188995
mod ID: M6ASITE012467		Click to Show/Hide the Full List
mod site	chr12:52077478-52077479:+		[3]
Sequence	GATGGGGAATAAAGTTGAGAACATGAGTTTGGGCTGAGCCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; A549; Huh7; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000336854.8
External Link	RMBase: m6A_site_189001

Ref 1	CircRAB11FIP1 promoted autophagy flux of ovarian cancer through DSC1 and miR-129. Cell Death Dis. 2021 Feb 26;12(2):219. doi: 10.1038/s41419-021-03486-1.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 5	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 6	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map