m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00182)
Target Name Ankyrin repeat and SOCS box protein 2 (ASB2)
Synonyms
ASB-2
    Click to Show/Hide
Gene Name ASB2
Chromosomal Location 14q32.12
Family ankyrin SOCS box (ASB) family
Function
Substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Mediates Notch-induced ubiquitination and degradation of substrates including TCF3/E2A and JAK2. Required during embryonic heart development for complete heart looping (By similarity). Required for cardiomyocyte differentiation. [Isoform 1]: Involved in myogenic differentiation and targets filamin FLNB for proteasomal degradation but not filamin FLNA. Also targets DES for proteasomal degradation (By similarity). Acts as a negative regulator of skeletal muscle mass (By similarity). [Isoform 2]: Targets filamins FLNA and FLNB for proteasomal degradation. This leads to enhanced adhesion of hematopoietic cells to fibronectin. Required for FLNA degradation in immature cardiomyocytes which is necessary for actin cytoskeleton remodeling, leading to proper organization of myofibrils and function of mature cardiomyocytes (By similarity). Required for degradation of FLNA and FLNB in immature dendritic cells (DC) which enhances immature DC migration by promoting DC podosome formation and DC-mediated degradation of the extracellular matrix (By similarity). Does not promote proteasomal degradation of tyrosine-protein kinases JAK1 or JAK2 in hematopoietic cells .
    Click to Show/Hide
Gene ID 51676
Uniprot ID
ASB2_HUMAN
HGNC ID
HGNC:16012
KEGG ID
hsa:51676
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ASB2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FTO
Cell Line NB4 cell line Homo sapiens
Treatment: shFTO NB4 cells
Control: shNS NB4 cells
 GSE103494
Regulation
logFC: 8.19E-01
p-value: 3.80E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary FTO enhances leukemic oncogene-mediated cell transformation and leukemogenesis, and inhibits all-trans-retinoic acid (ATRA)-induced AML cell differentiation, through regulating expression of targets such as Ankyrin repeat and SOCS box protein 2 (ASB2) and RARA by reducing m6A levels in these mRNA transcripts.
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Responsed Drug Tretinoin Approved
 Drug Info 
Cell Process RNA stability
RNA degradation (hsa03018)
In-vitro Model K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
Mono-Mac-6 Adult acute monocytic leukemia Homo sapiens CVCL_1426
Acute myeloid leukaemia [ICD-11: 2A60]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary FTO enhances leukemic oncogene-mediated cell transformation and leukemogenesis, and inhibits all-trans-retinoic acid (ATRA)-induced AML cell differentiation, through regulating expression of targets such as Ankyrin repeat and SOCS box protein 2 (ASB2) and RARA by reducing m6A levels in these mRNA transcripts.
Responsed Disease Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Tretinoin Approved
 Drug Info 
Cell Process RNA stability
RNA degradation (hsa03018)
In-vitro Model K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
Mono-Mac-6 Adult acute monocytic leukemia Homo sapiens CVCL_1426
Tretinoin [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary FTO enhances leukemic oncogene-mediated cell transformation and leukemogenesis, and inhibits all-trans-retinoic acid (ATRA)-induced AML cell differentiation, through regulating expression of targets such as Ankyrin repeat and SOCS box protein 2 (ASB2) and RARA by reducing m6A levels in these mRNA transcripts.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Acute myeloid leukaemia ICD-11: 2A60
 Disease Info 
Cell Process RNA stability
RNA degradation (hsa03018)
In-vitro Model K-562 Chronic myelogenous leukemia Homo sapiens CVCL_0004
KOCL-48 Childhood acute monocytic leukemia Homo sapiens CVCL_6867
Mono-Mac-6 Adult acute monocytic leukemia Homo sapiens CVCL_1426
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00182)
Ankyrin repeat and SOCS box protein 2 (ASB2)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006594 Click to Show/Hide the Full List
mod site chr14:93947015-93947016:- [2]
Sequence GTTGTTTAGATGAGGAAGCTAAGACACAGAGAGGTTGAGTG
Transcript ID List ENST00000555019.5; ENST00000556337.1; ENST00000555507.5; ENST00000315988.8
External Link RMBase: RNA-editing_site_40802
mod ID: A2ISITE006595 Click to Show/Hide the Full List
mod site chr14:93976497-93976498:- [3]
Sequence CGGGGAGCATGTTCTGAATTAAGACACTTTCAAGAAAATCC
Transcript ID List ENST00000555374.1; ENST00000555019.5; ENST00000555287.1; ENST00000556337.1
External Link RMBase: RNA-editing_site_40803