m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00170)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ACTA2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | LX2 cell line | Homo sapiens |
|
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
|
GSE207909 | |
| Regulation |
![]() ![]() |
logFC: -3.22E+00 p-value: 6.14E-220 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 knockdown decreased Actin, aortic smooth muscle (ACTA2) muscle actin. Taken together, our finding revealed that m6A methylation writer METTL3 serve as an oncogene in tumorigenesis of Gastric cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Gastric cancer | ICD-11: 2B72 | ||
| Cell Process | Cell proliferation | |||
| In-vitro Model | BGC-823 | Gastric carcinoma | Homo sapiens | CVCL_3360 |
| GES-1 | Normal | Homo sapiens | CVCL_EQ22 | |
| SGC-7901 | Gastric carcinoma | Homo sapiens | CVCL_0520 | |
Gastric cancer [ICD-11: 2B72]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 knockdown decreased Actin, aortic smooth muscle (ACTA2) muscle actin. Taken together, our finding revealed that m6A methylation writer METTL3 serve as an oncogene in tumorigenesis of Gastric cancer. | |||
| Responsed Disease | Gastric cancer [ICD-11: 2B72] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell proliferation | |||
| In-vitro Model | BGC-823 | Gastric carcinoma | Homo sapiens | CVCL_3360 |
| GES-1 | Normal | Homo sapiens | CVCL_EQ22 | |
| SGC-7901 | Gastric carcinoma | Homo sapiens | CVCL_0520 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03643 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Regulated Target | Histone H3 lysine 27 trimethylation (H3K27me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Gastric cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00170)
| In total 53 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE001276 | Click to Show/Hide the Full List | ||
| mod site | chr10:88935220-88935221:- | [2] | |
| Sequence | CCACCGCAAATGCTTCTAAAACACTTTCCTGCTCCTCTCTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T; endometrial | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109445 | ||
| mod ID: M6ASITE001277 | Click to Show/Hide the Full List | ||
| mod site | chr10:88935273-88935274:- | [3] | |
| Sequence | CAGCAGATGTGGATCAGCAAACAGGAATACGATGAAGCCGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109447 | ||
| mod ID: M6ASITE001278 | Click to Show/Hide the Full List | ||
| mod site | chr10:88938157-88938158:- | [2] | |
| Sequence | CAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109451 | ||
| mod ID: M6ASITE001279 | Click to Show/Hide the Full List | ||
| mod site | chr10:88938169-88938170:- | [4] | |
| Sequence | TGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109452 | ||
| mod ID: M6ASITE001280 | Click to Show/Hide the Full List | ||
| mod site | chr10:88938181-88938182:- | [5] | |
| Sequence | CATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109453 | ||
| mod ID: M6ASITE001281 | Click to Show/Hide the Full List | ||
| mod site | chr10:88938215-88938216:- | [4] | |
| Sequence | AGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109454 | ||
| mod ID: M6ASITE001282 | Click to Show/Hide the Full List | ||
| mod site | chr10:88939530-88939531:- | [4] | |
| Sequence | AACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109464 | ||
| mod ID: M6ASITE001283 | Click to Show/Hide the Full List | ||
| mod site | chr10:88939549-88939550:- | [5] | |
| Sequence | GTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGAC | ||
| Motif Score | 2.925321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109465 | ||
| mod ID: M6ASITE001284 | Click to Show/Hide the Full List | ||
| mod site | chr10:88939643-88939644:- | [4] | |
| Sequence | ACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109466 | ||
| mod ID: M6ASITE001285 | Click to Show/Hide the Full List | ||
| mod site | chr10:88939663-88939664:- | [4] | |
| Sequence | GTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109467 | ||
| mod ID: M6ASITE001286 | Click to Show/Hide the Full List | ||
| mod site | chr10:88939676-88939677:- | [4] | |
| Sequence | TGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; endometrial | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109468 | ||
| mod ID: M6ASITE001287 | Click to Show/Hide the Full List | ||
| mod site | chr10:88941022-88941023:- | [4] | |
| Sequence | CTTGAGGAGAACAGTTATAGACACCCAGTGTTATGCATTAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109473 | ||
| mod ID: M6ASITE001288 | Click to Show/Hide the Full List | ||
| mod site | chr10:88941032-88941033:- | [4] | |
| Sequence | ACACTATTTCCTTGAGGAGAACAGTTATAGACACCCAGTGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109474 | ||
| mod ID: M6ASITE001289 | Click to Show/Hide the Full List | ||
| mod site | chr10:88941278-88941279:- | [5] | |
| Sequence | GGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109475 | ||
| mod ID: M6ASITE001290 | Click to Show/Hide the Full List | ||
| mod site | chr10:88941377-88941378:- | [3] | |
| Sequence | TCTCCCAGGCATCGTGCTGGACTCTGGAGATGGTGTCACCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109476 | ||
| mod ID: M6ASITE001291 | Click to Show/Hide the Full List | ||
| mod site | chr10:88941790-88941791:- | [2] | |
| Sequence | CTCTCTATGCCTCTGGACGCACAACTGGTAGGTGGCTGGGC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000480297.5; ENST00000458159.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109477 | ||
| mod ID: M6ASITE001292 | Click to Show/Hide the Full List | ||
| mod site | chr10:88941856-88941857:- | [3] | |
| Sequence | CTTTGCAGATTATGTTTGAGACTTTCAATGTCCCAGCCATG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000480297.5; ENST00000224784.10; ENST00000458159.5 | ||
| External Link | RMBase: m6A_site_109478 | ||
| mod ID: M6ASITE001293 | Click to Show/Hide the Full List | ||
| mod site | chr10:88943827-88943828:- | [3] | |
| Sequence | GCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000458159.5; ENST00000224784.10; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109479 | ||
| mod ID: M6ASITE001294 | Click to Show/Hide the Full List | ||
| mod site | chr10:88943887-88943888:- | [2] | |
| Sequence | GATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000458159.5; ENST00000415557.1; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109480 | ||
| mod ID: M6ASITE001295 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946910-88946911:- | [3] | |
| Sequence | GGGAACATCACACACCGGGGACTGTTGTGGGGTGGGGGGAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000488967.5; ENST00000415557.1; rmsk_3374502; ENST00000480297.5; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109481 | ||
| mod ID: M6ASITE001296 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946926-88946927:- | [3] | |
| Sequence | ACATGGACACAGGAAGGGGAACATCACACACCGGGGACTGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415557.1; rmsk_3374502; ENST00000458159.5; ENST00000488967.5; ENST00000224784.10; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109482 | ||
| mod ID: M6ASITE001297 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946940-88946941:- | [3] | |
| Sequence | TGAACAACGAGAACACATGGACACAGGAAGGGGAACATCAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000458159.5; ENST00000488967.5; ENST00000415557.1; rmsk_3374502; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109483 | ||
| mod ID: M6ASITE001298 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946948-88946949:- | [3] | |
| Sequence | GTGGGAATTGAACAACGAGAACACATGGACACAGGAAGGGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000458159.5; ENST00000224784.10; rmsk_3374502; ENST00000488967.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109484 | ||
| mod ID: M6ASITE001299 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946957-88946958:- | [3] | |
| Sequence | CACTCATAGGTGGGAATTGAACAACGAGAACACATGGACAC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | rmsk_3374502; ENST00000480297.5; ENST00000458159.5; ENST00000488967.5; ENST00000415557.1; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109485 | ||
| mod ID: M6ASITE001300 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946991-88946992:- | [3] | |
| Sequence | TCGCAAGGACAAAAAACCAAACACCGCATGTTCTCACTCAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000480297.5; rmsk_3374502; ENST00000415557.1; ENST00000458159.5; ENST00000488967.5 | ||
| External Link | RMBase: m6A_site_109486 | ||
| mod ID: M6ASITE001301 | Click to Show/Hide the Full List | ||
| mod site | chr10:88946996-88946997:- | [3] | |
| Sequence | AACTGTCGCAAGGACAAAAAACCAAACACCGCATGTTCTCA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000224784.10; ENST00000480297.5; rmsk_3374502; ENST00000415557.1; ENST00000488967.5 | ||
| External Link | RMBase: m6A_site_109487 | ||
| mod ID: M6ASITE001302 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947003-88947004:- | [3] | |
| Sequence | CTCAGCAAACTGTCGCAAGGACAAAAAACCAAACACCGCAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000458159.5; ENST00000224784.10; ENST00000480297.5; ENST00000488967.5; rmsk_3374502 | ||
| External Link | RMBase: m6A_site_109488 | ||
| mod ID: M6ASITE001303 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947015-88947016:- | [3] | |
| Sequence | GAAACCATCATCCTCAGCAAACTGTCGCAAGGACAAAAAAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000488967.5; ENST00000480297.5; rmsk_3374502; ENST00000458159.5; ENST00000415557.1; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109489 | ||
| mod ID: M6ASITE001304 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947032-88947033:- | [3] | |
| Sequence | GGACATGGATGAAGCTGGAAACCATCATCCTCAGCAAACTG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000458159.5; ENST00000415557.1; rmsk_3374502; ENST00000480297.5; ENST00000488967.5 | ||
| External Link | RMBase: m6A_site_109490 | ||
| mod ID: M6ASITE001305 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947050-88947051:- | [3] | |
| Sequence | AGTTCATGTCCTTTGTAGGGACATGGATGAAGCTGGAAACC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415557.1; rmsk_3374502; ENST00000458159.5; ENST00000480297.5; ENST00000224784.10; ENST00000488967.5 | ||
| External Link | RMBase: m6A_site_109491 | ||
| mod ID: M6ASITE001306 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947192-88947193:- | [3] | |
| Sequence | CCTGTGTTCTCTGATACAGAACACCACACTACTGCTGGGGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000224784.10; ENST00000488967.5; ENST00000458159.5; ENST00000415557.1; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109492 | ||
| mod ID: M6ASITE001307 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947293-88947294:- | [4] | |
| Sequence | ACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000224784.10; ENST00000458159.5; ENST00000488967.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109493 | ||
| mod ID: M6ASITE001308 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947335-88947336:- | [6] | |
| Sequence | AGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | brain; liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000488967.5; ENST00000458159.5; ENST00000224784.10; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109494 | ||
| mod ID: M6ASITE001309 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947357-88947358:- | [4] | |
| Sequence | GGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000480297.5; ENST00000488967.5; ENST00000415557.1; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109495 | ||
| mod ID: M6ASITE001310 | Click to Show/Hide the Full List | ||
| mod site | chr10:88947365-88947366:- | [4] | |
| Sequence | GGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000224784.10; ENST00000488967.5; ENST00000480297.5; ENST00000458159.5 | ||
| External Link | RMBase: m6A_site_109496 | ||
| mod ID: M6ASITE001311 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948282-88948283:- | [4] | |
| Sequence | GGTGGCATCACATGGTAAAAACTCAGTAATTTCACCTCAGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000488967.5; ENST00000224784.10; ENST00000482085.1; ENST00000480297.5; ENST00000415557.1; ENST00000458159.5 | ||
| External Link | RMBase: m6A_site_109497 | ||
| mod ID: M6ASITE001312 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948312-88948313:- | [3] | |
| Sequence | ATTTTACACATTATGTGTAAACAAAGTATTGGTGGCATCAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000482085.1; ENST00000488967.5; ENST00000224784.10; ENST00000480297.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109498 | ||
| mod ID: M6ASITE001313 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948346-88948347:- | [3] | |
| Sequence | TGTCAACAAAATATATTTGGACAGCCGCATGGTAATTTTAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000458159.5; ENST00000482085.1; ENST00000224784.10; ENST00000488967.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109499 | ||
| mod ID: M6ASITE001314 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948769-88948770:- | [3] | |
| Sequence | TATGATTGGAACATAACAGGACACAGATTAGGTTCCTCTGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000482085.1; ENST00000488967.5; ENST00000458159.5; ENST00000224784.10; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109500 | ||
| mod ID: M6ASITE001315 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948779-88948780:- | [3] | |
| Sequence | TGAGGAAAATTATGATTGGAACATAACAGGACACAGATTAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482085.1; ENST00000415557.1; ENST00000488967.5; ENST00000224784.10; ENST00000458159.5; ENST00000480297.5 | ||
| External Link | RMBase: m6A_site_109501 | ||
| mod ID: M6ASITE001316 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948807-88948808:- | [6] | |
| Sequence | TCCATTGTGGGACGTCCCAGACATCAGGTGAGGAAAATTAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | liver; hESC-HEK293T; endometrial | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000488967.5; ENST00000224784.10; ENST00000415557.1; ENST00000482085.1; ENST00000458159.5 | ||
| External Link | RMBase: m6A_site_109502 | ||
| mod ID: M6ASITE001317 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948892-88948893:- | [2] | |
| Sequence | CAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000482085.1; ENST00000488967.5; ENST00000458159.5; ENST00000480297.5; ENST00000224784.10; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109503 | ||
| mod ID: M6ASITE001318 | Click to Show/Hide the Full List | ||
| mod site | chr10:88948913-88948914:- | [7] | |
| Sequence | AGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | fibroblasts; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000480297.5; ENST00000415557.1; ENST00000488967.5; ENST00000224784.10; ENST00000482085.1; ENST00000458159.5 | ||
| External Link | RMBase: m6A_site_109504 | ||
| mod ID: M6ASITE001319 | Click to Show/Hide the Full List | ||
| mod site | chr10:88952770-88952771:- | [7] | |
| Sequence | TCAGCTTTCAGCTTCCCTGAACACCACCCAGTGTGGAGCAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | fibroblasts; MT4; GSC-11; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000458159.5; ENST00000482085.1; ENST00000488967.5; ENST00000224784.10 | ||
| External Link | RMBase: m6A_site_109505 | ||
| mod ID: M6ASITE001320 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990108-88990109:- | [4] | |
| Sequence | TTTTATTTCTCAAGAGGAAAACAAAGCTAACAACTTAAGCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000651408.1; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109506 | ||
| mod ID: M6ASITE001321 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990195-88990196:- | [4] | |
| Sequence | CACAGACGTTTCTGGAATGGACAGTTAACCATATGAAAAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; GM12878; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000651408.1; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109507 | ||
| mod ID: M6ASITE001322 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990269-88990270:- | [4] | |
| Sequence | CTGGAGTCACTCAGAGAAAGACTTGCGGGGCATTTGACTGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; GM12878; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000458159.5; ENST00000651408.1; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109508 | ||
| mod ID: M6ASITE001323 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990423-88990424:- | [4] | |
| Sequence | CATGCTCACTTCAGGTGAGGACCTCGAGAGCCGGCCTCCTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000458159.5; ENST00000651408.1 | ||
| External Link | RMBase: m6A_site_109509 | ||
| mod ID: M6ASITE001324 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990676-88990677:- | [4] | |
| Sequence | CTCCCCAGAAGCGTCTTTGAACACCTGTGTGTCACTCTTGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; hESCs; GM12878; HEK293A-TOA; MSC; iSLK; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651408.1; ENST00000458159.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109510 | ||
| mod ID: M6ASITE001325 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990709-88990710:- | [4] | |
| Sequence | TCCAGCCAAGTCACTCGTAAACCGCTTCCCTCACTCCCCAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; GM12878; HEK293A-TOA; MSC; iSLK; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000651408.1; ENST00000458159.5 | ||
| External Link | RMBase: m6A_site_109511 | ||
| mod ID: M6ASITE001329 | Click to Show/Hide the Full List | ||
| mod site | chr10:88990948-88990949:- | [7] | |
| Sequence | CCACTTTGCCTATCCCCGGGACTAAGACGGGGTAAGCCTCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | fibroblasts; MT4; GSC-11; HEK293A-TOA; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651408.1; ENST00000458159.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109515 | ||
| mod ID: M6ASITE001335 | Click to Show/Hide the Full List | ||
| mod site | chr10:88991248-88991249:- | [4] | |
| Sequence | GCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCCTGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; MT4; MSC; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651408.1; ENST00000458159.5; ENST00000415557.1 | ||
| External Link | RMBase: m6A_site_109521 | ||
| mod ID: M6ASITE001339 | Click to Show/Hide the Full List | ||
| mod site | chr10:88991337-88991338:- | [4] | |
| Sequence | ACCCACCCGCGCCGGAGCGGACCTTTGGCTTGGCTTGTCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415557.1; ENST00000651408.1 | ||
| External Link | RMBase: m6A_site_109525 | ||
References

