General Information of the m6A Target Gene (ID: M6ATAR00166)
Target Name ATP-binding cassette sub-family D member 1 (ABCD1)
Synonyms
Adrenoleukodystrophy protein; ALDP; ALD
    Click to Show/Hide
Gene Name ABCD1
Chromosomal Location Xq28
Family ABC transporter superfamily; ABCD family; Peroxisomal fatty acyl CoA transporter (TC 3;A;1;203) subfamily
Function
ATP-dependent transporter of the ATP-binding cassette (ABC) family involved in the transport of very long chain fatty acid (VLCFA)-CoA from the cytosol to the peroxisome lumen. Coupled to the ATP-dependent transporter activity has also a fatty acyl-CoA thioesterase activity (ACOT) and hydrolyzes VLCFA-CoA into VLCFA prior their ATP-dependent transport into peroxisomes, the ACOT activity is essential during this transport process. Thus, plays a role in regulation of VLCFAs and energy metabolism namely, in the degradation and biosynthesis of fatty acids by beta-oxidation, mitochondrial function and microsomal fatty acid elongation. Involved in several processes; namely, controls the active myelination phase by negatively regulating the microsomal fatty acid elongation activity and may also play a role in axon and myelin maintenance. Controls also the cellular response to oxidative stress by regulating mitochondrial functions such as mitochondrial oxidative phosphorylation and depolarization. And finally controls the inflammatory response by positively regulating peroxisomal beta-oxidation of VLCFAs (By similarity).
    Click to Show/Hide
Gene ID 215
Uniprot ID
ABCD1_HUMAN
HGNC ID
HGNC:61
KEGG ID
hsa:215
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ABCD1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line MOLM-13 cell line Homo sapiens
Treatment: shMETTL3 MOLM13 cells
Control: MOLM13 cells
GSE98623
Regulation
logFC: -9.42E-01
p-value: 1.69E-05
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between ABCD1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 8.82E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knockdown of METTL3 in clear cell renal cell carcinoma cell line impaired both cell migration capacity and tumor spheroid formation in soft fibrin gel, a mechanical method for selecting stem-cell-like tumorigenic cells. METTL3 knockdown cells and functional studies confirmed that translation of ATP-binding cassette sub-family D member 1 (ABCD1).
Target Regulation Up regulation
Responsed Disease Renal cell carcinoma of kidney ICD-11: 2C90.0
Pathway Response ABC transporters hsa02010
Cell Process Cell migration and spheroid formation
In-vitro Model 786-O Renal cell carcinoma Homo sapiens CVCL_1051
A-498 Renal cell carcinoma Homo sapiens CVCL_1056
In-vivo Model A498 cells (1 × 106 cells) were resuspended in 100 uL of PBS and subcutaneously injected into the axillary fossa of nude mice (BALB/c-nude, 4 weeks old).
Renal cell carcinoma [ICD-11: 2C90]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Knockdown of METTL3 in clear cell renal cell carcinoma cell line impaired both cell migration capacity and tumor spheroid formation in soft fibrin gel, a mechanical method for selecting stem-cell-like tumorigenic cells. METTL3 knockdown cells and functional studies confirmed that translation of ATP-binding cassette sub-family D member 1 (ABCD1).
Responsed Disease Renal cell carcinoma of kidney [ICD-11: 2C90.0]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response ABC transporters hsa02010
Cell Process Cell migration and spheroid formation
In-vitro Model 786-O Renal cell carcinoma Homo sapiens CVCL_1051
A-498 Renal cell carcinoma Homo sapiens CVCL_1056
In-vivo Model A498 cells (1 × 106 cells) were resuspended in 100 uL of PBS and subcutaneously injected into the axillary fossa of nude mice (BALB/c-nude, 4 weeks old).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00166)
ATP-binding cassette sub-family D member 1 (ABCD1)
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004614 Click to Show/Hide the Full List
mod site chrX:153737241-153737242:+
Sequence GAGGTGGTGGTGGCCAGCCTCAACATCAGGGTAGGTCCAGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000443684.2; ENST00000218104.6
External Link RMBase: m5C_site_45585
mod ID: M5CSITE004615 Click to Show/Hide the Full List
mod site chrX:153744654-153744655:+ [2]
Sequence AGCGCCTGCCCGAGAGAGACCCCACCGCCACCGTGTGCCTT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m5C_site_45586
N6-methyladenosine (m6A)
In total 31 m6A sequence/site(s) in this target gene
mod ID: M6ASITE093827 Click to Show/Hide the Full List
mod site chrX:153724974-153724975:+ [3]
Sequence AGACGCCCCCTCTGCCCGAGACCTCTCAAGGCCCTGACCTC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; HEK293T; H1A; H1B; hNPCs; hESCs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876845
mod ID: M6ASITE093828 Click to Show/Hide the Full List
mod site chrX:153725011-153725012:+ [4]
Sequence CCTCAGGGGCCAGGGCACTGACAGGACAGGAGAGCCAAGTT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876846
mod ID: M6ASITE093829 Click to Show/Hide the Full List
mod site chrX:153725016-153725017:+ [3]
Sequence GGGGCCAGGGCACTGACAGGACAGGAGAGCCAAGTTCCTCC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876847
mod ID: M6ASITE093830 Click to Show/Hide the Full List
mod site chrX:153725164-153725165:+ [3]
Sequence CAAGGTTTCCAGTTGCCTAGACAACAGGCCCAGGGTCAGAG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876848
mod ID: M6ASITE093831 Click to Show/Hide the Full List
mod site chrX:153725303-153725304:+ [3]
Sequence GCCCCGGCCCTGGCGGGGGAACACGCTGAAGCGCACGGCCG
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876849
mod ID: M6ASITE093832 Click to Show/Hide the Full List
mod site chrX:153725468-153725469:+ [3]
Sequence GGCGGCCAAAGCTGGCATGAACCGGGTATTCCTGCAGCGGC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; MM6; GSC-11; HEK293T; HEK293A-TOA; TREX; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876850
mod ID: M6ASITE093833 Click to Show/Hide the Full List
mod site chrX:153725642-153725643:+ [3]
Sequence CCGCTGCATCGTCCGCAAGGACCCGCGGGCTTTTGGCTGGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; H1B; hESCs; A549; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TREX; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876851
mod ID: M6ASITE093834 Click to Show/Hide the Full List
mod site chrX:153725800-153725801:+ [3]
Sequence GCCTCTACTTCTCCCAGCAGACCTACTACCGGGTCAGCAAC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; GM12878; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876852
mod ID: M6ASITE093835 Click to Show/Hide the Full List
mod site chrX:153725819-153725820:+ [4]
Sequence GACCTACTACCGGGTCAGCAACATGGACGGGCGGCTTCGCA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000370129.4; ENST00000218104.6
External Link RMBase: m6A_site_876853
mod ID: M6ASITE093836 Click to Show/Hide the Full List
mod site chrX:153725945-153725946:+ [4]
Sequence GGACGTGGCTGTGACTTCCTACACCCTGCTTCGGGCGGCCC
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000218104.6; ENST00000370129.4
External Link RMBase: m6A_site_876854
mod ID: M6ASITE093837 Click to Show/Hide the Full List
mod site chrX:153729265-153729266:+ [3]
Sequence GCTACAGCGCTCCTACCAGGACCTGGCCTCGCAGATCAACC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6; ENST00000370129.4
External Link RMBase: m6A_site_876855
mod ID: M6ASITE093838 Click to Show/Hide the Full List
mod site chrX:153729417-153729418:+ [5]
Sequence GCTACTCAGAGTCAGGTGAGACCCAGGGCTCCAAGAGGATC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000370129.4; ENST00000218104.6
External Link RMBase: m6A_site_876856
mod ID: M6ASITE093839 Click to Show/Hide the Full List
mod site chrX:153729636-153729637:+ [3]
Sequence CGCCCTTTGTTACCACTCAGACAAGCCCAGGACTGCAAGTC
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; H1B; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000370129.4; ENST00000218104.6
External Link RMBase: m6A_site_876857
mod ID: M6ASITE093840 Click to Show/Hide the Full List
mod site chrX:153729647-153729648:+ [3]
Sequence ACCACTCAGACAAGCCCAGGACTGCAAGTCAGGAACACTAC
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; H1B; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000370129.4; ENST00000218104.6
External Link RMBase: m6A_site_876858
mod ID: M6ASITE093841 Click to Show/Hide the Full List
mod site chrX:153729661-153729662:+ [3]
Sequence CCCAGGACTGCAAGTCAGGAACACTACATGTCACTTCTCCA
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000370129.4; ENST00000218104.6
External Link RMBase: m6A_site_876859
mod ID: M6ASITE093842 Click to Show/Hide the Full List
mod site chrX:153729806-153729807:+ [3]
Sequence CTTGGTTTCCTCGCCCTGAAACAGCTCTTGCACCCTAAGGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6; ENST00000370129.4
External Link RMBase: m6A_site_876860
mod ID: M6ASITE093843 Click to Show/Hide the Full List
mod site chrX:153736464-153736465:+ [3]
Sequence ACGCTCAGGCGGGGTCTGGGACCATAGGCCGGTCTGGTGTC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000443684.2; ENST00000218104.6
External Link RMBase: m6A_site_876869
mod ID: M6ASITE093844 Click to Show/Hide the Full List
mod site chrX:153737175-153737176:+ [3]
Sequence GGCCAGGTGGTGGATGTGGAACAGGGGATCATCTGCGAGAA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000443684.2; ENST00000218104.6
External Link RMBase: m6A_site_876870
mod ID: M6ASITE093845 Click to Show/Hide the Full List
mod site chrX:153737195-153737196:+ [3]
Sequence ACAGGGGATCATCTGCGAGAACATCCCCATCGTCACGCCCT
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; peripheral-blood; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000443684.2; ENST00000218104.6
External Link RMBase: m6A_site_876871
mod ID: M6ASITE093846 Click to Show/Hide the Full List
mod site chrX:153740620-153740621:+ [3]
Sequence TGACCAGGTGATCTACCCGGACTCAGTGGAGGACATGCAAA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876876
mod ID: M6ASITE093847 Click to Show/Hide the Full List
mod site chrX:153740632-153740633:+ [3]
Sequence CTACCCGGACTCAGTGGAGGACATGCAAAGGAAGGGCTACT
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876877
mod ID: M6ASITE093848 Click to Show/Hide the Full List
mod site chrX:153740662-153740663:+ [3]
Sequence GAAGGGCTACTCGGAGCAGGACCTGGAAGCCATCCTGGACG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876878
mod ID: M6ASITE093849 Click to Show/Hide the Full List
mod site chrX:153743550-153743551:+ [3]
Sequence CTGGAAGTTCGAGAAGCTGGACTCAGCTGCCCGCCTGAGCC
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEC-1-A
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876879
mod ID: M6ASITE093850 Click to Show/Hide the Full List
mod site chrX:153743788-153743789:+ [3]
Sequence GCTCGGATCACATGAAGGAGACAGCAGCACCCACCCATGCA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876880
mod ID: M6ASITE093851 Click to Show/Hide the Full List
mod site chrX:153743849-153743850:+ [3]
Sequence CTGGCCCCTCCTCCTAGAAAACCCTTCCCGCCCTCGGGAAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876881
mod ID: M6ASITE093852 Click to Show/Hide the Full List
mod site chrX:153744099-153744100:+ [3]
Sequence CAGGTGGCCTCCCTCCAGAGACTCGAGTCCCCATGATTCCC
Motif Score 3.319380952
Cell/Tissue List HeLa; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876882
mod ID: M6ASITE093853 Click to Show/Hide the Full List
mod site chrX:153744140-153744141:+ [3]
Sequence TCCTCGTCAGTCTCTCAAAGACCCCATGGTCCATCCCCTGA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; MM6; iSLK; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876883
mod ID: M6ASITE093854 Click to Show/Hide the Full List
mod site chrX:153744216-153744217:+ [3]
Sequence CATAAAAGCCGCCCAGTGGGACCCACAGTCACACAGAGCGC
Motif Score 3.622404762
Cell/Tissue List HeLa; MM6; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876884
mod ID: M6ASITE093855 Click to Show/Hide the Full List
mod site chrX:153744485-153744486:+ [3]
Sequence CCGGCTCCCACCGGTGCCAAACCCAGCCCCTGCGGCCGTCA
Motif Score 2.185083333
Cell/Tissue List HeLa; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876885
mod ID: M6ASITE093856 Click to Show/Hide the Full List
mod site chrX:153744574-153744575:+ [3]
Sequence CTTGCCAGCCAGGAGTGCGGACACCATGTTCCCAGCTCAGT
Motif Score 3.643047619
Cell/Tissue List HeLa; MM6; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876886
mod ID: M6ASITE093857 Click to Show/Hide the Full List
mod site chrX:153744652-153744653:+ [3]
Sequence CCAGCGCCTGCCCGAGAGAGACCCCACCGCCACCGTGTGCC
Motif Score 2.876744048
Cell/Tissue List HeLa; MM6
Seq Type List m6A-seq
Transcript ID List ENST00000218104.6
External Link RMBase: m6A_site_876887