m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00159)

Target Name	eIF4E-binding protein 1 (4EBP1/EIF4EBP1)
Synonyms	4E-BP1; eIF4E-binding protein 1; Phosphorylated heat- and acid-stable protein regulated by insulin 1; PHAS-I Click to Show/Hide
Gene Name	EIF4EBP1
Chromosomal Location	8p11.23
Family	eIF4E-binding protein family
Function	Repressor of translation initiation that regulates EIF4E activity by preventing its assembly into the eIF4F complex: hypophosphorylated form competes with EIF4G1/EIF4G3 and strongly binds to EIF4E, leading to repress translation. In contrast, hyperphosphorylated form dissociates from EIF4E, allowing interaction between EIF4G1/EIF4G3 and EIF4E, leading to initiation of translation. Mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Click to Show/Hide
Gene ID	1978
Uniprot ID	4EBP1_HUMAN
HGNC ID	HGNC:3288
KEGG ID	hsa:1978

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

EIF4EBP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shMETTL3 MOLM13 cells Control: MOLM13 cells		GSE98623
Regulation		logFC: 8.71E-01 p-value: 3.32E-08
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between EIF4EBP1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 9.71E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/eIF4E-binding protein 1 (4EBP1/EIF4EBP1) pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulation	Down regulation
Responsed Disease	Retinoblastoma		ICD-11: 2D02.2	Disease Info
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shALKBH5 MOLM-13 cells Control: shNS MOLM-13 cells		GSE144968
Regulation		logFC: -7.12E-01 p-value: 2.44E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Bioactive peptides can inhibit acute myeloid leukemia cell proliferation by downregulating ALKBH5-mediated m6A demethylation of eIF4E-binding protein 1 (4EBP1/EIF4EBP1) and MLST8 mRNAs, which have potential to prevent and treat this disease.
Target Regulation	Up regulation
Responsed Disease	Acute myeloid leukaemia		ICD-11: 2A60	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	HL-60 cells (1 × 10⁷) suspended in 0.1 ml PBS containing 50% Matrigel were subcutaneously injected into the flanks of the mice. When tumor sizes reached 200 mm³, the mice were randomly distributed into four groups with the indicated dosages of saline, cytarabine and BP alone or in combination. For BP injections, the solution was delivered intraperitoneally at 10⁶ ug/kg body weight for the first 8 consecutive days. For cytarabine injections, the solution was delivered intraperitoneally at 100 mg/kg body weight three times (once every three days). The combination group was administered intraperitoneally three times (once every three days) with the same dosages as described above. The control group was treated with an equivalent amount of saline.

Acute myeloid leukaemia [ICD-11: 2A60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Bioactive peptides can inhibit acute myeloid leukemia cell proliferation by downregulating ALKBH5-mediated m6A demethylation of eIF4E-binding protein 1 (4EBP1/EIF4EBP1) and MLST8 mRNAs, which have potential to prevent and treat this disease.
Responsed Disease	Acute myeloid leukaemia [ICD-11: 2A60]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell apoptosis
In-vitro Model	MV4-11	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0064
	HL-60	Adult acute myeloid leukemia	Homo sapiens	CVCL_0002
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	HL-60 cells (1 × 10⁷) suspended in 0.1 ml PBS containing 50% Matrigel were subcutaneously injected into the flanks of the mice. When tumor sizes reached 200 mm³, the mice were randomly distributed into four groups with the indicated dosages of saline, cytarabine and BP alone or in combination. For BP injections, the solution was delivered intraperitoneally at 10⁶ ug/kg body weight for the first 8 consecutive days. For cytarabine injections, the solution was delivered intraperitoneally at 100 mg/kg body weight three times (once every three days). The combination group was administered intraperitoneally three times (once every three days) with the same dosages as described above. The control group was treated with an equivalent amount of saline.

Retina cancer [ICD-11: 2D02]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/eIF4E-binding protein 1 (4EBP1/EIF4EBP1) pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Responsed Disease	Retinoblastoma [ICD-11: 2D02.2]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Rapamycin		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

Rapamycin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3 promotes the progression of retinoblastoma through PI3K/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-P70S6K/eIF4E-binding protein 1 (4EBP1/EIF4EBP1) pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Retinoblastoma		ICD-11: 2D02.2	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
	mTOR signaling pathway			hsa04150
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	WERI-Rb-1	Retinoblastoma	Homo sapiens	CVCL_1792
	Y-79	Retinoblastoma	Homo sapiens	CVCL_1893
In-vivo Model	To establish a subcutaneous tumour model in nude mice, 2 × 10⁷ Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 10⁶ per mouse).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 5 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03257		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 4C (KDM4C)
Regulated Target	Histone H3 lysine 9 trimethylation (H3K9me3)
Crosstalk relationship	Histone modification → m6A
Disease	Acute myeloid leukaemia	Disease Info
Crosstalk ID: M6ACROT03261		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase 2A (KMT2A)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Acute myeloid leukaemia	Disease Info
Crosstalk ID: M6ACROT03265		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase 2C (KMT2C)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Acute myeloid leukaemia	Disease Info
Crosstalk ID: M6ACROT03269		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 4B (KDM4B)
Regulated Target	Histone H3 lysine 9 trimethylation (H3K9me3)
Crosstalk relationship	Histone modification → m6A
Disease	Acute myeloid leukaemia	Disease Info
Crosstalk ID: M6ACROT03273		Crosstalk Info
Epigenetic Regulator	Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C)
Regulated Target	Histone H3 lysine 9 trimethylation (H3K9me3)
Crosstalk relationship	Histone modification → m6A
Disease	Acute myeloid leukaemia	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00159)

eIF4E-binding protein 1 (4EBP1/EIF4EBP1)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002517		Click to Show/Hide the Full List
mod site	chr8:38041330-38041331:+		[3]
Sequence	CAGGCTGGTCTCGAACTTCTAACCTCAGGCGATCTGCCTGC
Transcript ID List	ENST00000338825.5
External Link	RMBase: RNA-editing_site_130352
mod ID: A2ISITE002518		Click to Show/Hide the Full List
mod site	chr8:38041331-38041332:+		[3]
Sequence	AGGCTGGTCTCGAACTTCTAACCTCAGGCGATCTGCCTGCC
Transcript ID List	ENST00000338825.5
External Link	RMBase: RNA-editing_site_130353
mod ID: A2ISITE002519		Click to Show/Hide the Full List
mod site	chr8:38042848-38042849:+		[3]
Sequence	CAAGGCGGGCAGATCGCTTGAGGTCAGGAGTTCAAGACCAG
Transcript ID List	ENST00000338825.5; rmsk_2492715
External Link	RMBase: RNA-editing_site_130354
mod ID: A2ISITE002520		Click to Show/Hide the Full List
mod site	chr8:38053342-38053343:+		[3]
Sequence	TTTTGTTTTGTTTTGTTTTGAGACAGGGTCTTGTTCTGTCG
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: RNA-editing_site_130355

N6-methyladenosine (m6A)

In total 16 m6A sequence/site(s) in this target gene
mod ID: M6ASITE084562		Click to Show/Hide the Full List
mod site	chr8:38030570-38030571:+		[4]
Sequence	GCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; H1B; H1A; hESCs; fibroblasts; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000338825.5
External Link	RMBase: m6A_site_793852
mod ID: M6ASITE084563		Click to Show/Hide the Full List
mod site	chr8:38030600-38030601:+		[4]
Sequence	GGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCCATCCCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; hESCs; fibroblasts; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000338825.5
External Link	RMBase: m6A_site_793853
mod ID: M6ASITE084564		Click to Show/Hide the Full List
mod site	chr8:38030670-38030671:+		[4]
Sequence	CGTGCAGCTCCCGCCCGGGGACTACAGCACGACCCCCGGCG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; fibroblasts; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000338825.5
External Link	RMBase: m6A_site_793854
mod ID: M6ASITE084565		Click to Show/Hide the Full List
mod site	chr8:38047375-38047376:+		[4]
Sequence	GAAAAAAGGATTGAGCAAAGACCGGCAAATATGTGGGTAAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; TREX; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000520657.1; ENST00000338825.5
External Link	RMBase: m6A_site_793855
mod ID: M6ASITE084566		Click to Show/Hide the Full List
mod site	chr8:38057125-38057126:+		[4]
Sequence	ATTCCTGATGGAGTGTCGGAACTCACCTGTGACCAAAACAC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; TREX; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793856
mod ID: M6ASITE084567		Click to Show/Hide the Full List
mod site	chr8:38057142-38057143:+		[4]
Sequence	GGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793857
mod ID: M6ASITE084568		Click to Show/Hide the Full List
mod site	chr8:38057224-38057225:+		[5]
Sequence	CATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAG
Motif Score	2.032470238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000520657.1; ENST00000338825.5
External Link	RMBase: m6A_site_793858
mod ID: M6ASITE084569		Click to Show/Hide the Full List
mod site	chr8:38059927-38059928:+		[4]
Sequence	AGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; HepG2; hNPCs; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; peripheral-blood; TREX; endometrial; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793859
mod ID: M6ASITE084570		Click to Show/Hide the Full List
mod site	chr8:38060053-38060054:+		[4]
Sequence	AGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; kidney; hESC-HEK293T; hESCs; A549; H1299; MM6; Huh7; peripheral-blood; iSLK; TIME; TREX; endometrial; HEC-1-A; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793860
mod ID: M6ASITE084571		Click to Show/Hide the Full List
mod site	chr8:38060075-38060076:+		[5]
Sequence	ACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTC
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000520657.1; ENST00000338825.5
External Link	RMBase: m6A_site_793861
mod ID: M6ASITE084572		Click to Show/Hide the Full List
mod site	chr8:38060106-38060107:+		[4]
Sequence	CTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; hESCs; fibroblasts; H1299; MM6; Huh7; peripheral-blood; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793862
mod ID: M6ASITE084573		Click to Show/Hide the Full List
mod site	chr8:38060118-38060119:+		[5]
Sequence	CTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGA
Motif Score	2.089839286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793863
mod ID: M6ASITE084574		Click to Show/Hide the Full List
mod site	chr8:38060179-38060180:+		[6]
Sequence	GGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793864
mod ID: M6ASITE084575		Click to Show/Hide the Full List
mod site	chr8:38060208-38060209:+		[4]
Sequence	AGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTCCTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; CD4T; peripheral-blood; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793865
mod ID: M6ASITE084576		Click to Show/Hide the Full List
mod site	chr8:38060214-38060215:+		[5]
Sequence	GGGCCAGGAAGTGGACAAGAACGAACCCTTCCTTCCGAATG
Motif Score	2.925321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000520657.1; ENST00000338825.5
External Link	RMBase: m6A_site_793866
mod ID: M6ASITE084577		Click to Show/Hide the Full List
mod site	chr8:38060218-38060219:+		[4]
Sequence	CAGGAAGTGGACAAGAACGAACCCTTCCTTCCGAATGATCA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; CD4T; peripheral-blood; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000338825.5; ENST00000520657.1
External Link	RMBase: m6A_site_793867

Ref 1	m(6)A methyltransferase METTL3 promotes retinoblastoma progression via PI3K/AKT/mTOR pathway. J Cell Mol Med. 2020 Oct 8;24(21):12368-78. doi: 10.1111/jcmm.15736. Online ahead of print.
Ref 2	Bioactive peptide inhibits acute myeloid leukemia cell proliferation by downregulating ALKBH5-mediated m(6)A demethylation of EIF4EBP1 and MLST8 mRNA. Cell Oncol (Dordr). 2022 Jun;45(3):355-365. doi: 10.1007/s13402-022-00666-9. Epub 2022 May 17.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map