m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00158)

Target Name	DNA-3-methyladenine glycosylase (ANPG/MPG)
Synonyms	3-alkyladenine DNA glycosylase; 3-methyladenine DNA glycosidase; ADPG; N-methylpurine-DNA glycosylase; AAG; ANPG; MID1 Click to Show/Hide
Gene Name	MPG
Chromosomal Location	16p13.3
Family	DNA glycosylase MPG family
Function	Hydrolysis of the deoxyribose N-glycosidic bond to excise 3-methyladenine, and 7-methylguanine from the damaged DNA polymer formed by alkylation lesions. Click to Show/Hide
Gene ID	4350
Uniprot ID	3MG_HUMAN
HGNC ID	HGNC:7211
KEGG ID	hsa:4350

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MPG can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: -6.00E-01 p-value: 3.04E-08
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Two critical DNA repair genes (MGMT and DNA-3-methyladenine glycosylase (ANPG/MPG)) were m6A-modified by METTL3, whereas inhibited by METTL3 silencing or DAA-mediated total methylation inhibition, which is crucial for METTL3-improved temozolomide resistance in glioblastoma cells.
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Responsed Drug	Temozolomide		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	DNA repair
In-vitro Model	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	Subcutaneously injected shMETTL3 or shNC-expressing U87-MG-TMZ cells into BALB/c NOD mice. After confirmation of GBM implantation, mice were treated with TMZ (66 mg/kg/d, 5 d per week, for 3 cycles).

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Two critical DNA repair genes (MGMT and DNA-3-methyladenine glycosylase (ANPG/MPG)) were m6A-modified by METTL3, whereas inhibited by METTL3 silencing or DAA-mediated total methylation inhibition, which is crucial for METTL3-improved temozolomide resistance in glioblastoma cells.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Temozolomide		Approved	Drug Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	DNA repair
In-vitro Model	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	Subcutaneously injected shMETTL3 or shNC-expressing U87-MG-TMZ cells into BALB/c NOD mice. After confirmation of GBM implantation, mice were treated with TMZ (66 mg/kg/d, 5 d per week, for 3 cycles).

Temozolomide [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Two critical DNA repair genes (MGMT and DNA-3-methyladenine glycosylase (ANPG/MPG)) were m6A-modified by METTL3, whereas inhibited by METTL3 silencing or DAA-mediated total methylation inhibition, which is crucial for METTL3-improved temozolomide resistance in glioblastoma cells.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	DNA repair
In-vitro Model	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vivo Model	Subcutaneously injected shMETTL3 or shNC-expressing U87-MG-TMZ cells into BALB/c NOD mice. After confirmation of GBM implantation, mice were treated with TMZ (66 mg/kg/d, 5 d per week, for 3 cycles).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03298		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info
Drug	Temozolomide	Drug Info
Crosstalk ID: M6ACROT03302		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00158)

DNA-3-methyladenine glycosylase (ANPG/MPG)

5-methylcytidine (m5C)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000493		Click to Show/Hide the Full List
mod site	chr16:79153-79154:+
Sequence	CCCAGGTCATGCAGCCTGGGCCCCCATGCCGTGCAGCTCGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000219431.4; ENST00000356432.7; ENST00000397817.5; ENST00000436333.5; ENST00000475280.1
External Link	RMBase: m5C_site_14634
mod ID: M5CSITE000494		Click to Show/Hide the Full List
mod site	chr16:79154-79155:+
Sequence	CCAGGTCATGCAGCCTGGGCCCCCATGCCGTGCAGCTCGCA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000219431.4; ENST00000356432.7; ENST00000436333.5; ENST00000475280.1; ENST00000397817.5
External Link	RMBase: m5C_site_14635
mod ID: M5CSITE000495		Click to Show/Hide the Full List
mod site	chr16:79155-79156:+
Sequence	CAGGTCATGCAGCCTGGGCCCCCATGCCGTGCAGCTCGCAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000356432.7; ENST00000475280.1; ENST00000219431.4; ENST00000436333.5; ENST00000397817.5
External Link	RMBase: m5C_site_14636
mod ID: M5CSITE000496		Click to Show/Hide the Full List
mod site	chr16:79156-79157:+
Sequence	AGGTCATGCAGCCTGGGCCCCCATGCCGTGCAGCTCGCACA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000436333.5; ENST00000397817.5; ENST00000219431.4; ENST00000356432.7; ENST00000475280.1
External Link	RMBase: m5C_site_14637
mod ID: M5CSITE000497		Click to Show/Hide the Full List
mod site	chr16:83261-83262:+		[3]
Sequence	ACATCTCCAGCCAGGGTGAGCAGTGCTGGGGCACGGGGGGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000356432.7; ENST00000219431.4; ENST00000397817.5; ENST00000436333.5
External Link	RMBase: m5C_site_14638

N6-methyladenosine (m6A)

In total 22 m6A sequence/site(s) in this target gene
mod ID: M6ASITE025088		Click to Show/Hide the Full List
mod site	chr16:77011-77012:+		[4]
Sequence	CCTGTTAGCCTTTCTGTAGGACCAGGTGTCACACTCATCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000436333.5
External Link	RMBase: m6A_site_298328
mod ID: M6ASITE025089		Click to Show/Hide the Full List
mod site	chr16:77042-77043:+		[4]
Sequence	CACTCATCTGAGGGCTCCAGACACATGGCCTGTGCGTCTGT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397817.5; ENST00000436333.5
External Link	RMBase: m6A_site_298329
mod ID: M6ASITE025090		Click to Show/Hide the Full List
mod site	chr16:78088-78089:+		[4]
Sequence	GGGCCCGGGAATCGGTCCGGACCTGGCGGTGGGCGCTGGGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000397817.5; ENST00000356432.7; ENST00000436333.5
External Link	RMBase: m6A_site_298330
mod ID: M6ASITE025091		Click to Show/Hide the Full List
mod site	chr16:79321-79322:+		[4]
Sequence	CCCGCTTTGCAGATGAAGAAACCAAAGCAGGTGGTCAGATC
Motif Score	2.185083333
Cell/Tissue List	HeLa; MM6; HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000436333.5; ENST00000219431.4; ENST00000356432.7; ENST00000475280.1; ENST00000397817.5
External Link	RMBase: m6A_site_298331
mod ID: M6ASITE025092		Click to Show/Hide the Full List
mod site	chr16:79573-79574:+		[4]
Sequence	CCCAGGGAGCGCTGCTTGGGACCGCCCACCACTCCGGGCCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; MM6; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000219431.4; ENST00000397817.5; ENST00000356432.7; ENST00000436333.5; ENST00000475280.1
External Link	RMBase: m6A_site_298332
mod ID: M6ASITE025093		Click to Show/Hide the Full List
mod site	chr16:79696-79697:+		[5]
Sequence	CTGGCCCGGGCATTTCTGGGACAGGTAATGTGAACATAGCA
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000475280.1; ENST00000436333.5; ENST00000356432.7; ENST00000219431.4; ENST00000397817.5
External Link	RMBase: m6A_site_298333
mod ID: M6ASITE025094		Click to Show/Hide the Full List
mod site	chr16:79709-79710:+		[5]
Sequence	TTCTGGGACAGGTAATGTGAACATAGCAGCGAGGGCCCTCC
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000475280.1; ENST00000219431.4; ENST00000356432.7; ENST00000436333.5; ENST00000397817.5
External Link	RMBase: m6A_site_298334
mod ID: M6ASITE025095		Click to Show/Hide the Full List
mod site	chr16:79760-79761:+		[5]
Sequence	GTCACTGCAGTTGTCCCTGAACCCCTGTCCGCTGCCTGCTG
Motif Score	2.930744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000219431.4; ENST00000356432.7; ENST00000436333.5; ENST00000397817.5; ENST00000475280.1
External Link	RMBase: m6A_site_298335
mod ID: M6ASITE025096		Click to Show/Hide the Full List
mod site	chr16:83083-83084:+		[6]
Sequence	CGACTTCCTAATGGCACAGAACTCCGAGGCCGCATCGTGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; MT4; MM6; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000356432.7; ENST00000219431.4; ENST00000397817.5; ENST00000436333.5
External Link	RMBase: m6A_site_298336
mod ID: M6ASITE025097		Click to Show/Hide the Full List
mod site	chr16:83105-83106:+		[7]
Sequence	TCCGAGGCCGCATCGTGGAGACCGAGGCATACCTGGGGCCA
Motif Score	2.876744048
Cell/Tissue List	HepG2; HeLa; MT4; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000436333.5; ENST00000397817.5; ENST00000219431.4; ENST00000356432.7
External Link	RMBase: m6A_site_298337
mod ID: M6ASITE025098		Click to Show/Hide the Full List
mod site	chr16:83162-83163:+		[7]
Sequence	ACTCAAGGGGTGGCCGGCAGACCCCCCGCAACCGAGGCATG
Motif Score	2.876744048
Cell/Tissue List	HepG2; HeLa; MT4; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000219431.4; ENST00000436333.5; ENST00000397817.5; ENST00000356432.7
External Link	RMBase: m6A_site_298338
mod ID: M6ASITE025099		Click to Show/Hide the Full List
mod site	chr16:83198-83199:+		[7]
Sequence	GCATGTTCATGAAGCCGGGGACCCTGTACGTGTACATCATT
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; MT4; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000356432.7; ENST00000219431.4; ENST00000397817.5; ENST00000436333.5
External Link	RMBase: m6A_site_298339
mod ID: M6ASITE025100		Click to Show/Hide the Full List
mod site	chr16:83241-83242:+		[4]
Sequence	CGGCATGTACTTCTGCATGAACATCTCCAGCCAGGGTGAGC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000219431.4; ENST00000436333.5; ENST00000397817.5; ENST00000356432.7
External Link	RMBase: m6A_site_298340
mod ID: M6ASITE025101		Click to Show/Hide the Full List
mod site	chr16:85453-85454:+		[4]
Sequence	AGCCCCTGGAAGGTCTGGAGACCATGCGTCAGCTTCGCAGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; MM6; peripheral-blood; GSC-11; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000397817.5; ENST00000436333.5; ENST00000219431.4; ENST00000356432.7
External Link	RMBase: m6A_site_298346
mod ID: M6ASITE025102		Click to Show/Hide the Full List
mod site	chr16:85511-85512:+		[4]
Sequence	CGCCAGCCGTGTCCTCAAGGACCGCGAGCTCTGCAGTGGCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; A549; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397817.5; ENST00000436333.5; ENST00000356432.7; ENST00000219431.4
External Link	RMBase: m6A_site_298348
mod ID: M6ASITE025103		Click to Show/Hide the Full List
mod site	chr16:85583-85584:+		[4]
Sequence	CAAGAGCTTTGACCAGAGGGACCTGGCACAGGATGAAGCTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397817.5; ENST00000356432.7; ENST00000436333.5; ENST00000219431.4
External Link	RMBase: m6A_site_298349
mod ID: M6ASITE025104		Click to Show/Hide the Full List
mod site	chr16:85698-85699:+		[4]
Sequence	GCAGGGGAGTGGGCCCGGAAACCCCTCCGCTTCTATGTCCG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; LCLs; A549; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397817.5; ENST00000219431.4; ENST00000356432.7
External Link	RMBase: m6A_site_298351
mod ID: M6ASITE025105		Click to Show/Hide the Full List
mod site	chr16:85745-85746:+		[8]
Sequence	CCCCTGGGTCAGTGTGGTCGACAGAGTGGCTGAGCAGGACA
Motif Score	2.865571429
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000219431.4; ENST00000356432.7; ENST00000397817.5
External Link	RMBase: m6A_site_298353
mod ID: M6ASITE025106		Click to Show/Hide the Full List
mod site	chr16:85763-85764:+		[4]
Sequence	CGACAGAGTGGCTGAGCAGGACACACAGGCCTGAGCAAAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; TREX; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000356432.7; ENST00000219431.4; ENST00000397817.5
External Link	RMBase: m6A_site_298354
mod ID: M6ASITE025107		Click to Show/Hide the Full List
mod site	chr16:85794-85795:+		[4]
Sequence	TGAGCAAAGGGCCTGCCCAGACAAGATTTTTTAATTGTTTA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; LCLs; MM6; CD4T; peripheral-blood; GSC-11; TREX; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; DART-seq; MeRIP-seq
Transcript ID List	ENST00000356432.7; ENST00000219431.4; ENST00000397817.5
External Link	RMBase: m6A_site_298355
mod ID: M6ASITE025108		Click to Show/Hide the Full List
mod site	chr16:85818-85819:+		[4]
Sequence	GATTTTTTAATTGTTTAAAAACCGAATAAATGTTTTATTTC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; A549; LCLs; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; TREX; iSLK; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397817.5; ENST00000356432.7; ENST00000219431.4
External Link	RMBase: m6A_site_298357
mod ID: M6ASITE025109		Click to Show/Hide the Full List
mod site	chr16:85845-85846:+		[4]
Sequence	AAATGTTTTATTTCTAGAAAACTGTGCCTTAGCCAGAGCTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; LCLs; MM6; peripheral-blood; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000356432.7; ENST00000397817.5
External Link	RMBase: m6A_site_298359

Ref 1	METTL3 Promotes the Resistance of Glioma to Temozolomide via Increasing MGMT and ANPG in a m(6)A Dependent Manner. Front Oncol. 2021 Jul 15;11:702983. doi: 10.3389/fonc.2021.702983. eCollection 2021.
Ref 2	Comparative studies on the cytochrome p450-associated metabolism and interaction potential of selegiline between human liver-derived in vitro systems. Drug Metab Dispos. 2003 Sep;31(9):1093-102. doi: 10.1124/dmd.31.9.1093.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 6	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 7	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 8	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map