m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00157)

Target Name	Long intergenic non-protein coding RNA 470 (LINC00470)
Synonyms	LINC00470; C18orf2; chromosome 18 open reading frame 2 Click to Show/Hide
Gene Name	LINC00470
Chromosomal Location	18p11.32
Family	Long intergenic non-protein coding RNAs
Gene ID	56651
HGNC ID	HGNC:1225

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

LINC00470 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HeLa cell line	Homo sapiens
Treatment: METTL3 knockdown HeLa cells Control: HeLa cells		GSE70061
Regulation		logFC: 5.89E-01 p-value: 3.48E-02
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The molecular mechanism underlying the effect of Long intergenic non-protein coding RNA 470 (LINC00470) on chronic myelocytic leukaemia by reducing the PTEN stability via RNA methyltransferase METTL3, thus leading to the inhibition of cell autophagy while promoting chemoresistance in CML.
Target Regulation	Up regulation
Responsed Disease	Chronic myeloid leukaemia		ICD-11: 2B33.2	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
Cell Process	Cell autophagy
In-vitro Model	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
In-vitro Model	KCL-22	Chronic myelogenous leukemia	Homo sapiens	CVCL_2091
In-vivo Model	In the control mice or ADR mice group, the parental or chemo-resistant K562 cells were infected with LV-shCtrl. In the ADR + shLINC00470 group, the chemo-resistant K562 cells were infected with LV- shLINC00470. These cells were injected, respectively, into these 5-week-old mice subcutaneously.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Long intergenic non-protein coding RNA 470 (LINC00470)-METTL3-mediated PTEN mRNA degradation relied on the m6A reader protein YTHDF2-dependent pathway.LINC00470 served as a therapeutic target for Gastric cancer patients.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	Gastric cancer			hsa05226
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Long intergenic non-protein coding RNA 470 (LINC00470)-METTL3-mediated PTEN mRNA degradation relied on the m6A reader protein YTHDF2-dependent pathway. LINC00470 served as a therapeutic target for Gastric cancer patients.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	Gastric cancer			hsa05226
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

Malignant haematopoietic neoplasm [ICD-11: 2B33]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The molecular mechanism underlying the effect of Long intergenic non-protein coding RNA 470 (LINC00470) on chronic myelocytic leukaemia by reducing the PTEN stability via RNA methyltransferase METTL3, thus leading to the inhibition of cell autophagy while promoting chemoresistance in CML.
Responsed Disease	Chronic myeloid leukaemia [ICD-11: 2B33.2]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Autophagy			hsa04140
Cell Process	RNA stability
	Cell autophagy
In-vitro Model	K-562	Chronic myelogenous leukemia	Homo sapiens	CVCL_0004
	KCL-22	Chronic myelogenous leukemia	Homo sapiens	CVCL_2091
In-vivo Model	In the control mice or ADR mice group, the parental or chemo-resistant K562 cells were infected with LV-shCtrl. In the ADR + shLINC00470 group, the chemo-resistant K562 cells were infected with LV- shLINC00470. These cells were injected, respectively, into these 5-week-old mice subcutaneously.

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Long intergenic non-protein coding RNA 470 (LINC00470)-METTL3-mediated PTEN mRNA degradation relied on the m6A reader protein YTHDF2-dependent pathway.LINC00470 served as a therapeutic target for Gastric cancer patients.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Gastric cancer			hsa05226
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	Long intergenic non-protein coding RNA 470 (LINC00470)-METTL3-mediated PTEN mRNA degradation relied on the m6A reader protein YTHDF2-dependent pathway. LINC00470 served as a therapeutic target for Gastric cancer patients.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Gastric cancer			hsa05226
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
	BGC-823	Gastric carcinoma	Homo sapiens	CVCL_3360
	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03647		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05401		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 470 (LINC00470)
Regulated Target	Mutated in multiple advanced cancers 1 (PTEN)
Crosstalk relationship	m6A → ncRNA
Disease	Gastric cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05402		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 470 (LINC00470)
Regulated Target	Mutated in multiple advanced cancers 1 (PTEN)
Crosstalk relationship	m6A → ncRNA
Disease	Gastric cancer	Disease Info
Crosstalk ID: M6ACROT05487		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 470 (LINC00470)
Regulated Target	Mutated in multiple advanced cancers 1 (PTEN)
Crosstalk relationship	m6A → ncRNA
Disease	Chronic myeloid leukaemia	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00157)

Long intergenic non-protein coding RNA 470 (LINC00470)

N6-methyladenosine (m6A)

In total 15 m6A sequence/site(s) in this target gene
mod ID: M6ASITE036613		Click to Show/Hide the Full List
mod site	chr18:1362553-1362554:-		[3]
Sequence	TCGGCCTGTTCAACAGCAGGACCTGCATCGGGCAATTGAAA
Motif Score	3.622404762
Cell/Tissue List	TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000581430.5; ENST00000412816.7; ENST00000579735.1
External Link	RMBase: m6A_site_392124
mod ID: M6ASITE036614		Click to Show/Hide the Full List
mod site	chr18:1362662-1362663:-		[3]
Sequence	TGATGCGTTTTCAGGAAGGGACCTAAATGCGATGTGTTGAG
Motif Score	3.622404762
Cell/Tissue List	TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000581430.5; ENST00000412816.7
External Link	RMBase: m6A_site_392125
mod ID: M6ASITE036615		Click to Show/Hide the Full List
mod site	chr18:1362684-1362685:-		[3]
Sequence	TGCTAGAAGTTGCCCAGGAAACTGATGCGTTTTCAGGAAGG
Motif Score	2.627720238
Cell/Tissue List	TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000412816.7; ENST00000579735.1; ENST00000581430.5
External Link	RMBase: m6A_site_392126
mod ID: M6ASITE036616		Click to Show/Hide the Full List
mod site	chr18:1362707-1362708:-		[3]
Sequence	AAATGTGGATAGGCATGTAGACCTGCTAGAAGTTGCCCAGG
Motif Score	2.876744048
Cell/Tissue List	TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000412816.7; ENST00000581430.5
External Link	RMBase: m6A_site_392127
mod ID: M6ASITE036617		Click to Show/Hide the Full List
mod site	chr18:1362745-1362746:-		[4]
Sequence	CAGAAAGAAGCAATCCTGAAACTCATCTTGAAAAATGAAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000581430.5; ENST00000412816.7
External Link	RMBase: m6A_site_392128
mod ID: M6ASITE036618		Click to Show/Hide the Full List
mod site	chr18:1362766-1362767:-		[4]
Sequence	ATCAACCAGCCTGCTTTAAAACAGAAAGAAGCAATCCTGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000581430.5; ENST00000412816.7
External Link	RMBase: m6A_site_392129
mod ID: M6ASITE036619		Click to Show/Hide the Full List
mod site	chr18:1362788-1362789:-		[5]
Sequence	AAGAATTCCTACAAGATTTCACATCAACCAGCCTGCTTTAA
Motif Score	2.047297619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000581430.5; ENST00000579735.1; ENST00000412816.7
External Link	RMBase: m6A_site_392130
mod ID: M6ASITE036620		Click to Show/Hide the Full List
mod site	chr18:1362830-1362831:-		[4]
Sequence	AGCTACCATTCATCCTCAGGACATTGACACGGCTATAACGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000412816.7; ENST00000581430.5
External Link	RMBase: m6A_site_392131
mod ID: M6ASITE036621		Click to Show/Hide the Full List
mod site	chr18:1362884-1362885:-		[4]
Sequence	GAGTCTCTGGGATGGACTGGACACTGATCACCGCTGCCAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000581430.5; ENST00000412816.7
External Link	RMBase: m6A_site_392132
mod ID: M6ASITE036622		Click to Show/Hide the Full List
mod site	chr18:1362889-1362890:-		[4]
Sequence	TTTATGAGTCTCTGGGATGGACTGGACACTGATCACCGCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000412816.7; ENST00000581430.5
External Link	RMBase: m6A_site_392133
mod ID: M6ASITE036623		Click to Show/Hide the Full List
mod site	chr18:1362957-1362958:-		[4]
Sequence	AATAGACTCCTTTGTACGAAACCGTTCAGAGTTCTGACCAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000581430.5; ENST00000412816.7
External Link	RMBase: m6A_site_392134
mod ID: M6ASITE036624		Click to Show/Hide the Full List
mod site	chr18:1362972-1362973:-		[4]
Sequence	CATCATTATAGACGAAATAGACTCCTTTGTACGAAACCGTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; U2OS; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000579735.1; ENST00000412816.7; ENST00000581430.5
External Link	RMBase: m6A_site_392135
mod ID: M6ASITE036625		Click to Show/Hide the Full List
mod site	chr18:1362981-1362982:-		[5]
Sequence	ACTGTCCATCATCATTATAGACGAAATAGACTCCTTTGTAC
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000581430.5; ENST00000412816.7; ENST00000579735.1
External Link	RMBase: m6A_site_392136
mod ID: M6ASITE036626		Click to Show/Hide the Full List
mod site	chr18:1363042-1363043:-		[6]
Sequence	AGTGGTATGGAGAATCTCAAACACTGGCTGCTGCTGTCTTC
Motif Score	2.20572619
Cell/Tissue List	U2OS
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000581430.5; ENST00000412816.7; ENST00000579735.1
External Link	RMBase: m6A_site_392137
mod ID: M6ASITE036627		Click to Show/Hide the Full List
mod site	chr18:1363292-1363293:-		[5]
Sequence	ACCCTCTTAATATGCATGTTACTTGGAAGTGATATAGCAGG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000579735.1; ENST00000581430.5; ENST00000412816.7
External Link	RMBase: m6A_site_392138

Ref 1	Dysregulation of LINC00470 and METTL3 promotes chemoresistance and suppresses autophagy of chronic myelocytic leukaemia cells. J Cell Mol Med. 2021 May;25(9):4248-4259. doi: 10.1111/jcmm.16478. Epub 2021 Mar 21.
Ref 2	LncRNA LINC00470 promotes the degradation of PTEN mRNA to facilitate malignant behavior in gastric cancer cells. Biochem Biophys Res Commun. 2020 Jan 22;521(4):887-893. doi: 10.1016/j.bbrc.2019.11.016. Epub 2019 Nov 8.
Ref 3	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 4	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map