m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00139)
Target Name microRNA let-7g (MIRLET7G)
Synonyms
MIRLET7G; MIRNLET7G; hsa-let-7g
    Click to Show/Hide
Gene Name MIRLET7G
Chromosomal Location 3p21.2
Family MicroRNA MIRLET7 family
Gene ID 406890
HGNC ID
HGNC:31485
miRBase ID
MI0000433
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MIRLET7G can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary HBXIP up-regulates METTL3 by suppressing microRNA let-7g (MIRLET7G), in which METTL3 increased HBXIP expression forming a positive feedback loop of HBXIP/let-7g/METTL3/HBXIP, leading to accelerated cell proliferation in breast cancer.
Target Regulation Down regulation
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Cell Process Cell differentiation and apoptosis
Glutamine metabolism
Apoptosis (hsa04210)
Breast cancer [ICD-11: 2C60]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary HBXIP up-regulates METTL3 by suppressing microRNA let-7g (MIRLET7G), in which METTL3 increased HBXIP expression forming a positive feedback loop of HBXIP/let-7g/METTL3/HBXIP, leading to accelerated cell proliferation in breast cancer.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Cell Process Cell differentiation and apoptosis
Glutamine metabolism
Apoptosis (hsa04210)
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00139)
microRNA let-7g (MIRLET7G)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011935 Click to Show/Hide the Full List
mod site chr3:52268347-52268348:- [2]
Sequence TGATTCCAGGCTGAGGTAGTAGTTTGTACAGTTTGAGGGTC
Transcript ID List ENST00000296490.8; ENST00000469000.5; ENST00000463624.1; ENST00000362280.3; MIMAT0000414
External Link RMBase: RNA-editing_site_97225
mod ID: A2ISITE011936 Click to Show/Hide the Full List
mod site chr3:52268350-52268351:- [2]
Sequence GCCTGATTCCAGGCTGAGGTAGTAGTTTGTACAGTTTGAGG
Transcript ID List ENST00000469000.5; ENST00000463624.1; MIMAT0000414; ENST00000296490.8; ENST00000362280.3
External Link RMBase: RNA-editing_site_97226