m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00102)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
THAP7-AS1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | DKO-1 cell line | Homo sapiens |
|
Treatment: METTL3 knockdown DKO-1 cell
Control: DKO-1 cell
|
GSE182382 | |
| Regulation |
![]() ![]() |
logFC: -1.23E+00 p-value: 1.77E-02 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between THAP7-AS1 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 5.66E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | LV-sh-THAP7 antisense RNA 1 (THAP7-AS1) treatment could suppress gastric cancer growth. THAP7-AS1, transcriptionally activated by SP1 and then modified by METTL3-mediated m6A, exerts oncogenic functions, by promoting interaction between NLS and importin alpha-1 and then improving the CUL4B protein entry into the nucleus to repress the transcription of miR-22-3p and miR-320a. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Gastric cancer | ICD-11: 2B72 | ||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Cell growth | |||
| Cell invasion | ||||
| Cell metastasis | ||||
Gastric cancer [ICD-11: 2B72]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | LV-sh-THAP7 antisense RNA 1 (THAP7-AS1) treatment could suppress gastric cancer growth. THAP7-AS1, transcriptionally activated by SP1 and then modified by METTL3-mediated m6A, exerts oncogenic functions, by promoting interaction between NLS and importin alpha-1 and then improving the CUL4B protein entry into the nucleus to repress the transcription of miR-22-3p and miR-320a. | |||
| Responsed Disease | Gastric cancer [ICD-11: 2B72] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | PI3K-Akt signaling pathway | hsa04151 | ||
| Cell Process | Cell growth | |||
| Cell invasion | ||||
| Cell metastasis | ||||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03652 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Regulated Target | Histone H3 lysine 27 trimethylation (H3K27me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Gastric cancer | |
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05522 | ||
| Epigenetic Regulator | THAP7 antisense RNA 1 (THAP7-AS1) | |
| Regulated Target | Cullin 4B (CUL4B) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Gastric cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00102)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE011082 | Click to Show/Hide the Full List | ||
| mod site | chr22:21005766-21005767:+ | [2] | |
| Sequence | CAGGAGCTCGAGACCAGCTTAGCCAACATGGTGAAACCCTG | ||
| Transcript ID List | rmsk_5250205; ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: RNA-editing_site_90941 | ||
5-methylcytidine (m5C)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE002872 | Click to Show/Hide the Full List | ||
| mod site | chr22:21003231-21003232:+ | [3] | |
| Sequence | ATTGGCCTCAGAAATGGGAGCTCATTAAAAATCAGAGCTGT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m5C_site_30406 | ||
| mod ID: M5CSITE002873 | Click to Show/Hide the Full List | ||
| mod site | chr22:21003233-21003234:+ | [3] | |
| Sequence | TGGCCTCAGAAATGGGAGCTCATTAAAAATCAGAGCTGTGG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m5C_site_30407 | ||
N6-methyladenosine (m6A)
| In total 37 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE056600 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002154-21002155:+ | [4] | |
| Sequence | CGGAAGTTGGTACCATAGAGACTGGAGAGCCGGAGGTGCCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556360 | ||
| mod ID: M6ASITE056601 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002276-21002277:+ | [4] | |
| Sequence | GCGTCGTCCCAGCTCCCTGGACTACCAGTATTGTCGCCCAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000429962.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556361 | ||
| mod ID: M6ASITE056602 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002341-21002342:+ | [4] | |
| Sequence | GGCCTCACTTTTCTCCGTAAACACCCCGGCACGATGGAGCG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; GSC-11; HEK293A-TOA; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556362 | ||
| mod ID: M6ASITE056603 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002493-21002494:+ | [5] | |
| Sequence | ACGGGGCCTGGGACGCTTGCACGAAAGAACCCGACAAAAAC | ||
| Motif Score | 2.80452381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556363 | ||
| mod ID: M6ASITE056604 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002501-21002502:+ | [4] | |
| Sequence | TGGGACGCTTGCACGAAAGAACCCGACAAAAACCAGAGCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1; ENST00000429962.1 | ||
| External Link | RMBase: m6A_site_556364 | ||
| mod ID: M6ASITE056605 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002512-21002513:+ | [4] | |
| Sequence | CACGAAAGAACCCGACAAAAACCAGAGCCCGCACTCACTCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1; ENST00000429962.1 | ||
| External Link | RMBase: m6A_site_556365 | ||
| mod ID: M6ASITE056606 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002549-21002550:+ | [4] | |
| Sequence | CTCTCGTACTGGGGAGGTGGACTTCAGGGAGGGTTATCTGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556366 | ||
| mod ID: M6ASITE056607 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002605-21002606:+ | [4] | |
| Sequence | AAGTACAACACAGGAGAAAGACAGTATCGCAATACAGAAAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; GM12878; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000429962.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556367 | ||
| mod ID: M6ASITE056608 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002658-21002659:+ | [6] | |
| Sequence | TTTATTATTATTTTCCTGAGACCGGAGTCTCGCTCTGTCGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; HeLa; HEK293T; U2OS; H1B; H1A; GM12878; Huh7; HEK293A-TOA; TREX; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1; ENST00000429962.1 | ||
| External Link | RMBase: m6A_site_556368 | ||
| mod ID: M6ASITE056609 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002719-21002720:+ | [7] | |
| Sequence | GCGATCTCGGCTCACTGCAAACTCCGCCTCCCGGGTTCACG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; U2OS; HEK293A-TOA; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1; ENST00000429962.1 | ||
| External Link | RMBase: m6A_site_556369 | ||
| mod ID: M6ASITE056610 | Click to Show/Hide the Full List | ||
| mod site | chr22:21002774-21002775:+ | [7] | |
| Sequence | CACCCTCCACAGTAGCTGGGACTACAAGCGCCCGCCACCAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; U2OS; HEK293A-TOA; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556370 | ||
| mod ID: M6ASITE056611 | Click to Show/Hide the Full List | ||
| mod site | chr22:21003050-21003051:+ | [4] | |
| Sequence | ACTAAGGCGCACTTGGCCGAACTTATGGTCCAGGCAGGCCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000429962.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556371 | ||
| mod ID: M6ASITE056612 | Click to Show/Hide the Full List | ||
| mod site | chr22:21003145-21003146:+ | [8] | |
| Sequence | TGGCCAGGTCTCCCACAGGGACCACCGTGGGGGGCTGGTAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1; ENST00000429962.1 | ||
| External Link | RMBase: m6A_site_556374 | ||
| mod ID: M6ASITE056613 | Click to Show/Hide the Full List | ||
| mod site | chr22:21003254-21003255:+ | [8] | |
| Sequence | ATTAAAAATCAGAGCTGTGGACCAGTTCCAACACTGTGTTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T; Huh7; MSC | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000429962.1; ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556375 | ||
| mod ID: M6ASITE056614 | Click to Show/Hide the Full List | ||
| mod site | chr22:21008756-21008757:+ | [4] | |
| Sequence | TGCTTCCTGATGGCACAAGGACTCCACATCACCCAGTCCTA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; H1B; H1A; hNPCs; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556379 | ||
| mod ID: M6ASITE056615 | Click to Show/Hide the Full List | ||
| mod site | chr22:21008793-21008794:+ | [4] | |
| Sequence | CCTACCTTAAATCCAATCGGACACCAGTCCACAAACTGGTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556381 | ||
| mod ID: M6ASITE056616 | Click to Show/Hide the Full List | ||
| mod site | chr22:21008807-21008808:+ | [4] | |
| Sequence | AATCGGACACCAGTCCACAAACTGGTTGGTGTGCTTGCTCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; H1A; H1B; hNPCs; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556383 | ||
| mod ID: M6ASITE056617 | Click to Show/Hide the Full List | ||
| mod site | chr22:21008863-21008864:+ | [4] | |
| Sequence | CCGCACTGACATCTTTCAGGACCACATCCCCTCTGTACAAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; hNPCs; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556384 | ||
| mod ID: M6ASITE056618 | Click to Show/Hide the Full List | ||
| mod site | chr22:21008975-21008976:+ | [4] | |
| Sequence | ACTGGCGATCTTGGCCACGGACAGCTGCTCATGGTAGGCCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; hNPCs; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556385 | ||
| mod ID: M6ASITE056619 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009128-21009129:+ | [4] | |
| Sequence | CAGGGAGGCCGTGATGGAGGACACGATCTGCCCAGACGACT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; H1A; hNPCs; hESCs; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556387 | ||
| mod ID: M6ASITE056620 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009167-21009168:+ | [4] | |
| Sequence | CTGAGGTTGGTGTACATGGGACACTCGATGTCCAGGTTGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556388 | ||
| mod ID: M6ASITE056621 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009298-21009299:+ | [4] | |
| Sequence | GCTCCGTCATGGCCATGGAGACCTGGGGGGCTGGGCAAATG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556391 | ||
| mod ID: M6ASITE056622 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009323-21009324:+ | [4] | |
| Sequence | GGGGGCTGGGCAAATGGCAAACTCCAGCTTGGACTTCTTCC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556392 | ||
| mod ID: M6ASITE056623 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009335-21009336:+ | [4] | |
| Sequence | AATGGCAAACTCCAGCTTGGACTTCTTCCCGTAGTCCACCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; Huh7; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556393 | ||
| mod ID: M6ASITE056624 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009377-21009378:+ | [4] | |
| Sequence | GAGCCGCTTCATGAGCAGAGACACGAACCCAGAGCCAGTGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; Huh7; GSC-11; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556395 | ||
| mod ID: M6ASITE056625 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009383-21009384:+ | [4] | |
| Sequence | CTTCATGAGCAGAGACACGAACCCAGAGCCAGTGCCGCCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; Huh7; GSC-11; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556396 | ||
| mod ID: M6ASITE056626 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009462-21009463:+ | [9] | |
| Sequence | CACAGATCTGCCTGAGAGAAACCAGACAACGTAAGCCAATG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | Huh7; GSC-11; HEK293T | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556398 | ||
| mod ID: M6ASITE056627 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009467-21009468:+ | [9] | |
| Sequence | ATCTGCCTGAGAGAAACCAGACAACGTAAGCCAATGCCCGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7; GSC-11; HEK293T | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556399 | ||
| mod ID: M6ASITE056628 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009560-21009561:+ | [9] | |
| Sequence | GAGAGTTGATACGGATTCAGACCATCCATAATGAACACGCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556400 | ||
| mod ID: M6ASITE056629 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009574-21009575:+ | [9] | |
| Sequence | ATTCAGACCATCCATAATGAACACGCATCACACTTTGAAGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556401 | ||
| mod ID: M6ASITE056630 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009607-21009608:+ | [4] | |
| Sequence | TTTGAAGCAGAGAAAAGCAGACAATACAGATCTATGCACAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556402 | ||
| mod ID: M6ASITE056631 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009711-21009712:+ | [4] | |
| Sequence | CACAGAAGAAAAACGGATGGACTAACCAGAGCGCTCAGCCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; H1B; H1A; GM12878; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556403 | ||
| mod ID: M6ASITE056632 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009741-21009742:+ | [4] | |
| Sequence | GCGCTCAGCCAGCCTGCTGGACTGGCACCCGTGGCTACAGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; H1A; H1B; GM12878; Huh7; HEK293A-TOA; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556404 | ||
| mod ID: M6ASITE056633 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009761-21009762:+ | [4] | |
| Sequence | ACTGGCACCCGTGGCTACAGACACTCTTGTTTAGCACCATG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; H1A; H1B; GM12878; Huh7; HEK293A-TOA; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556405 | ||
| mod ID: M6ASITE056634 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009807-21009808:+ | [4] | |
| Sequence | CTCCCTGCACAGAAGCAAGGACTCAGGGCATTGCCCCCTCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; H1A; H1B; GM12878; Huh7; GSC-11; HEK293A-TOA; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000591411.5; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556406 | ||
| mod ID: M6ASITE056635 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009838-21009839:+ | [7] | |
| Sequence | TGCCCCCTCTCTACCTGAGAACTAGACTCAGCGCCCAGCAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; H1A; H1B; GM12878; Huh7; GSC-11; HEK293A-TOA; MSC; TIME | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000436079.1; ENST00000591411.5; ENST00000452284.1 | ||
| External Link | RMBase: m6A_site_556407 | ||
| mod ID: M6ASITE056636 | Click to Show/Hide the Full List | ||
| mod site | chr22:21009843-21009844:+ | [7] | |
| Sequence | CCTCTCTACCTGAGAACTAGACTCAGCGCCCAGCACTGGAT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; H1A; H1B; GM12878; Huh7; GSC-11; HEK293A-TOA; MSC; TIME | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000452284.1; ENST00000591411.5; ENST00000436079.1 | ||
| External Link | RMBase: m6A_site_556408 | ||
References

