General Information of the m6A Target Gene (ID: M6ATAR00100)
Target Name Long intergenic non-protein coding RNA 460 (LINC00460)
Synonyms
LINC00460
    Click to Show/Hide
Gene Name LINC00460
Chromosomal Location 13q33.2
Family Long intergenic non-protein coding RNAs
Gene ID 728192
HGNC ID
HGNC:42809
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LINC00460 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RIP-seq result supporting the interaction between LINC00460 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 6.69E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Long intergenic non-protein coding RNA 460 (LINC00460) is a novel oncogene of colorectal cancer through interacting with IGF2BP2 and DHX9 and bind to the m6A modified HMGA1 mRNA to enhance the HMGA1 mRNA stability. The N6-methyladenosine (m6A) modification of HMGA1 mRNA by METTL3 enhanced HMGA1 expression in CRC.
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
Pathway Response mRNA surveillance pathway hsa03015
Cell Process mRNA stability
Epithelial-mesenchymal transition
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
FHC Normal Homo sapiens CVCL_3688
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HEK293T Normal Homo sapiens CVCL_0063
HT29 Colon cancer Mus musculus CVCL_A8EZ
LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model Groups of HCT116-Luc-shCtrl, HCT116-Luc-shLINC00460, and HCT116-Luc-shLINC00460 + HMGA1 cells (5 × 106) were injected subcutaneously into the flanks of mice correspondingly.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Long intergenic non-protein coding RNA 460 (LINC00460) is a novel oncogene of colorectal cancer through interacting with IGF2BP2 and DHX9 and bind to the m6A modified HMGA1 mRNA to enhance the HMGA1 mRNA stability. The N6-methyladenosine (m6A) modification of HMGA1 mRNA by METTL3 enhanced HMGA1 expression in CRC.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response mRNA surveillance pathway hsa03015
Cell Process mRNA stability
Epithelial-mesenchymal transition
In-vitro Model DLD-1 Colon adenocarcinoma Homo sapiens CVCL_0248
FHC Normal Homo sapiens CVCL_3688
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
HEK293T Normal Homo sapiens CVCL_0063
HT29 Colon cancer Mus musculus CVCL_A8EZ
LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
SW480 Colon adenocarcinoma Homo sapiens CVCL_0546
SW620 Colon adenocarcinoma Homo sapiens CVCL_0547
In-vivo Model Groups of HCT116-Luc-shCtrl, HCT116-Luc-shLINC00460, and HCT116-Luc-shLINC00460 + HMGA1 cells (5 × 106) were injected subcutaneously into the flanks of mice correspondingly.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03553
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
Crosstalk ID: M6ACROT03598
Epigenetic Regulator N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05470
Epigenetic Regulator Long intergenic non-protein coding RNA 460 (LINC00460)
Regulated Target ATP-dependent RNA helicase A (DHX9)
Crosstalk relationship m6A → ncRNA
Disease Colorectal cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00100)
Long intergenic non-protein coding RNA 460 (LINC00460)
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE018360 Click to Show/Hide the Full List
mod site chr13:106376975-106376976:+ [2]
Sequence CTAAGAGTCACCCTGGATGAACCACCATTGCCAGCGGGGAG
Motif Score 2.930744048
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000642946.1; ENST00000647525.1; ENST00000444865.2; ENST00000435024.2; ENST00000439790.6; ENST00000643760.1
External Link RMBase: m6A_site_235170