m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00100)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LINC00460
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RIP-seq result supporting the interaction between LINC00460 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 6.69E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Long intergenic non-protein coding RNA 460 (LINC00460) is a novel oncogene of colorectal cancer through interacting with IGF2BP2 and DHX9 and bind to the m6A modified HMGA1 mRNA to enhance the HMGA1 mRNA stability. The N6-methyladenosine (m6A) modification of HMGA1 mRNA by METTL3 enhanced HMGA1 expression in CRC. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Pathway Response | mRNA surveillance pathway | hsa03015 | ||
| Cell Process | mRNA stability | |||
| Epithelial-mesenchymal transition | ||||
| In-vitro Model | DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 |
| FHC | Normal | Homo sapiens | CVCL_3688 | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 | |
| In-vivo Model | Groups of HCT116-Luc-shCtrl, HCT116-Luc-shLINC00460, and HCT116-Luc-shLINC00460 + HMGA1 cells (5 × 106) were injected subcutaneously into the flanks of mice correspondingly. | |||
Colorectal cancer [ICD-11: 2B91]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Long intergenic non-protein coding RNA 460 (LINC00460) is a novel oncogene of colorectal cancer through interacting with IGF2BP2 and DHX9 and bind to the m6A modified HMGA1 mRNA to enhance the HMGA1 mRNA stability. The N6-methyladenosine (m6A) modification of HMGA1 mRNA by METTL3 enhanced HMGA1 expression in CRC. | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | mRNA surveillance pathway | hsa03015 | ||
| Cell Process | mRNA stability | |||
| Epithelial-mesenchymal transition | ||||
| In-vitro Model | DLD-1 | Colon adenocarcinoma | Homo sapiens | CVCL_0248 |
| FHC | Normal | Homo sapiens | CVCL_3688 | |
| HCT 116 | Colon carcinoma | Homo sapiens | CVCL_0291 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| HT29 | Colon cancer | Mus musculus | CVCL_A8EZ | |
| LoVo | Colon adenocarcinoma | Homo sapiens | CVCL_0399 | |
| SW480 | Colon adenocarcinoma | Homo sapiens | CVCL_0546 | |
| SW620 | Colon adenocarcinoma | Homo sapiens | CVCL_0547 | |
| In-vivo Model | Groups of HCT116-Luc-shCtrl, HCT116-Luc-shLINC00460, and HCT116-Luc-shLINC00460 + HMGA1 cells (5 × 106) were injected subcutaneously into the flanks of mice correspondingly. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03553 | ||
| Epigenetic Regulator | Histone acetyltransferase p300 (P300) | |
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
| Crosstalk ID: M6ACROT03598 | ||
| Epigenetic Regulator | N-lysine methyltransferase SMYD2 (SMYD2) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05470 | ||
| Epigenetic Regulator | Long intergenic non-protein coding RNA 460 (LINC00460) | |
| Regulated Target | ATP-dependent RNA helicase A (DHX9) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Colorectal cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00100)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE018360 | Click to Show/Hide the Full List | ||
| mod site | chr13:106376975-106376976:+ | [2] | |
| Sequence | CTAAGAGTCACCCTGGATGAACCACCATTGCCAGCGGGGAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000642946.1; ENST00000647525.1; ENST00000444865.2; ENST00000435024.2; ENST00000439790.6; ENST00000643760.1 | ||
| External Link | RMBase: m6A_site_235170 | ||
References