m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00087)

Target Name	Cancer susceptibility 9 (CASC9)
Synonyms	CASC9; cancer susceptibility candidate 9 (non-protein coding); cancer susceptibility 9 (non-protein coding); LINC00981; ESCCAL-1; linc-JPH1; long intergenic non-protein coding RNA 981; esophageal squamous cell carcinoma associated lncRNA-1 Click to Show/Hide
Gene Name	CASC9
Chromosomal Location	8q21.13
Family	Long non-coding RNAs with non-systematic symbols
Gene ID	101805492
HGNC ID	HGNC:48906

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CASC9 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Cancer susceptibility 9 (CASC9)/IGF2BP2/HK2 axis promotes the aerobic glycolysis of glioblastoma multiforme.
Target Regulation	Up regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Pathway Response	Glycolysis / Gluconeogenesis			hsa00010
Cell Process	Aerobic glycolysis
In-vitro Model	NHA (Normal human astrocytes)
	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022

Brain cancer [ICD-11: 2A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Cancer susceptibility 9 (CASC9)/IGF2BP2/HK2 axis promotes the aerobic glycolysis of glioblastoma multiforme.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Glycolysis / Gluconeogenesis			hsa00010
Cell Process	Aerobic glycolysis
In-vitro Model	NHA (Normal human astrocytes)
	U251 (Fibroblasts or fibroblast like cells)
	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05525		Crosstalk Info
Epigenetic Regulator	Cancer susceptibility 9 (CASC9)
Regulated Target	Hexokinase-2 (HK2)
Crosstalk relationship	m6A → ncRNA
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00087)

Cancer susceptibility 9 (CASC9)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002667		Click to Show/Hide the Full List
mod site	chr8:75231847-75231848:-		[2]
Sequence	TGGCGGGCGCCTGTGGTCCCAGCTGCTCAGGAGGCTGAGGC
Transcript ID List	ENST00000521147.1; ENST00000522183.1; ENST00000523313.1; rmsk_2552680; ENST00000504531.2
External Link	RMBase: RNA-editing_site_131649

N6-methyladenosine (m6A)

In total 20 m6A sequence/site(s) in this target gene
mod ID: M6ASITE085643		Click to Show/Hide the Full List
mod site	chr8:75223501-75223502:-		[3]
Sequence	AAATAAGTATATCCTTGGAGACCTGTGGATGTTTTTTGAAA
Motif Score	2.876744048
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000504531.2; rmsk_2552666
External Link	RMBase: m6A_site_800964
mod ID: M6ASITE085644		Click to Show/Hide the Full List
mod site	chr8:75223634-75223635:-		[4]
Sequence	ATATAAATTTTAGAATTAAAACACAATATCTAAAAATAAAT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T; BGC823; Huh7
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000504531.2; rmsk_2552666
External Link	RMBase: m6A_site_800965
mod ID: M6ASITE085645		Click to Show/Hide the Full List
mod site	chr8:75223671-75223672:-		[5]
Sequence	TAATCTCAGCAGTCATGTAAACTATAAAAATAAGCAAATAT
Motif Score	2.627720238
Cell/Tissue List	HEK293T; BGC823; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000504531.2; rmsk_2552666
External Link	RMBase: m6A_site_800966
mod ID: M6ASITE085646		Click to Show/Hide the Full List
mod site	chr8:75223696-75223697:-		[5]
Sequence	CATGCTCACTATGAATGAAAACAGGTAATCTCAGCAGTCAT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; BGC823; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	rmsk_2552666; ENST00000504531.2
External Link	RMBase: m6A_site_800967
mod ID: M6ASITE085647		Click to Show/Hide the Full List
mod site	chr8:75223717-75223718:-		[5]
Sequence	GCCTAGTGAGGTAAATGCAAACATGCTCACTATGAATGAAA
Motif Score	2.20572619
Cell/Tissue List	HEK293T; BGC823; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	rmsk_2552666; ENST00000504531.2; ENST00000522183.1
External Link	RMBase: m6A_site_800968
mod ID: M6ASITE085648		Click to Show/Hide the Full List
mod site	chr8:75223762-75223763:-		[6]
Sequence	GCTAAAATTATAAGACAAAGACTTCAAAATAGCTATTTTAA
Motif Score	3.319380952
Cell/Tissue List	HEK293T; HeLa; hNPCs; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	rmsk_2552666; ENST00000522183.1; ENST00000504531.2
External Link	RMBase: m6A_site_800969
mod ID: M6ASITE085649		Click to Show/Hide the Full List
mod site	chr8:75223768-75223769:-		[6]
Sequence	AGAAATGCTAAAATTATAAGACAAAGACTTCAAAATAGCTA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; HeLa; hNPCs; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	rmsk_2552666; ENST00000522183.1; ENST00000521147.1; ENST00000504531.2
External Link	RMBase: m6A_site_800970
mod ID: M6ASITE085650		Click to Show/Hide the Full List
mod site	chr8:75223867-75223868:-		[6]
Sequence	AAAAGAAAGCTATTTCCTGGACTTTTCTTCATTAGAAATTA
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HeLa; hNPCs; fibroblasts; A549; Huh7; iSLK; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000522183.1; ENST00000521147.1; ENST00000504531.2
External Link	RMBase: m6A_site_800971
mod ID: M6ASITE085651		Click to Show/Hide the Full List
mod site	chr8:75223893-75223894:-		[6]
Sequence	CCAACTTTAATATGTCACAAACATAAAAAAGAAAGCTATTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HeLa; hNPCs; fibroblasts; A549; Huh7; iSLK; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000521147.1; ENST00000504531.2; ENST00000522183.1
External Link	RMBase: m6A_site_800972
mod ID: M6ASITE085652		Click to Show/Hide the Full List
mod site	chr8:75223929-75223930:-		[6]
Sequence	TCTAAACATAAGTTAGAAGAACCTTTCAACTGGATTCCAAC
Motif Score	2.930744048
Cell/Tissue List	HEK293T; HeLa; hNPCs; fibroblasts; A549; Huh7; iSLK; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000521147.1; ENST00000504531.2; ENST00000522183.1; ENST00000523313.1
External Link	RMBase: m6A_site_800973
mod ID: M6ASITE085653		Click to Show/Hide the Full List
mod site	chr8:75223944-75223945:-		[6]
Sequence	ATTTGCTGCTTCCATTCTAAACATAAGTTAGAAGAACCTTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HeLa; U2OS; fibroblasts; A549; Huh7; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000504531.2; ENST00000523313.1; ENST00000522183.1; ENST00000521147.1
External Link	RMBase: m6A_site_800974
mod ID: M6ASITE085654		Click to Show/Hide the Full List
mod site	chr8:75223968-75223969:-		[6]
Sequence	TTTCCAGAGTTTGCAGATGGACACATTTGCTGCTTCCATTC
Motif Score	3.643047619
Cell/Tissue List	HEK293T; HeLa; hESC-HEK293T; U2OS; fibroblasts; A549; Huh7; TREX
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000523313.1; ENST00000504531.2; ENST00000522183.1; ENST00000521147.1
External Link	RMBase: m6A_site_800975
mod ID: M6ASITE085655		Click to Show/Hide the Full List
mod site	chr8:75224039-75224040:-		[3]
Sequence	CCTCTTCTTCTGATCATGGGACTCATATTACCAGTCTTCAC
Motif Score	4.065041667
Cell/Tissue List	HEK293T; U2OS; fibroblasts; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000504531.2; ENST00000523313.1; ENST00000521147.1; ENST00000522183.1
External Link	RMBase: m6A_site_800976
mod ID: M6ASITE085656		Click to Show/Hide the Full List
mod site	chr8:75224121-75224122:-		[4]
Sequence	GAAAACCAGGTGGGACCCAGACAGCAGCAAAGCAATGGAAG
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hESC-HEK293T; A549; Huh7
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000523313.1; ENST00000522183.1; ENST00000521147.1; ENST00000504531.2
External Link	RMBase: m6A_site_800977
mod ID: M6ASITE085657		Click to Show/Hide the Full List
mod site	chr8:75224127-75224128:-		[3]
Sequence	AAAATTGAAAACCAGGTGGGACCCAGACAGCAGCAAAGCAA
Motif Score	3.622404762
Cell/Tissue List	HEK293T; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000521147.1; ENST00000504531.2; ENST00000523313.1; ENST00000522183.1
External Link	RMBase: m6A_site_800978
mod ID: M6ASITE085658		Click to Show/Hide the Full List
mod site	chr8:75224137-75224138:-		[3]
Sequence	AGACCCAAGCAAAATTGAAAACCAGGTGGGACCCAGACAGC
Motif Score	2.185083333
Cell/Tissue List	HEK293T; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000522183.1; rmsk_2552667; ENST00000523313.1; ENST00000521147.1; ENST00000504531.2
External Link	RMBase: m6A_site_800979
mod ID: M6ASITE085659		Click to Show/Hide the Full List
mod site	chr8:75224155-75224156:-		[3]
Sequence	TTTGAGAGAGGAGGAGAAAGACCCAAGCAAAATTGAAAACC
Motif Score	2.876744048
Cell/Tissue List	HEK293T; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000522183.1; ENST00000504531.2; ENST00000523313.1; rmsk_2552667; ENST00000521147.1
External Link	RMBase: m6A_site_800980
mod ID: M6ASITE085660		Click to Show/Hide the Full List
mod site	chr8:75224232-75224233:-		[3]
Sequence	AGAACAACACCTGGCAAGAAACAGGTTATGTTTGGCTGGAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000522183.1; rmsk_2552667; ENST00000504531.2; ENST00000523313.1; ENST00000521147.1
External Link	RMBase: m6A_site_800981
mod ID: M6ASITE085661		Click to Show/Hide the Full List
mod site	chr8:75224249-75224250:-		[3]
Sequence	ACATAGCCTGTGATAGCAGAACAACACCTGGCAAGAAACAG
Motif Score	2.951386905
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000521147.1; ENST00000504531.2; rmsk_2552667; ENST00000522183.1; ENST00000523313.1
External Link	RMBase: m6A_site_800982
mod ID: M6ASITE085662		Click to Show/Hide the Full List
mod site	chr8:75224269-75224270:-		[3]
Sequence	AAAGAATTTGCTTTTCTGGAACATAGCCTGTGATAGCAGAA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000522183.1; ENST00000521147.1; rmsk_2552667; ENST00000523313.1; ENST00000504531.2
External Link	RMBase: m6A_site_800983

Ref 1	m(6)A reader IGF2BP2-stabilized CASC9 accelerates glioblastoma aerobic glycolysis by enhancing HK2 mRNA stability. Cell Death Discov. 2021 Oct 13;7(1):292. doi: 10.1038/s41420-021-00674-y.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	METTL3-mediated N6-methyladenosine modification is critical for epithelial-mesenchymal transition and metastasis of gastric cancer. Mol Cancer. 2019 Oct 13;18(1):142. doi: 10.1186/s12943-019-1065-4.
Ref 6	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map