m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00082)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
KCNK15-AS1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | ALKBH5 inhibits pancreatic cancer motility by demethylating lncRNA KCNK15 and WISP2 antisense RNA 1 (KCNK15-AS1). | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Pancreatic cancer | ICD-11: 2C10 | ||
| Cell Process | Epithelial-mesenchymal transition | |||
| Cell migration and invasion | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| BxPC-3 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0186 | |
| HPDE6c7 | Normal | Homo sapiens | CVCL_0P38 | |
| MIA PaCa-2 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0428 | |
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | ALKBH5-mediated m6A demethylation enhanced the stability of KCNK15-AS1. In pancreatic cancer, KCNK15 and WISP2 antisense RNA 1 (KCNK15-AS1) bound to KCNK15 to inhibit its translation, and interacted with MDM2 to induce REST ubiquitination, which eventually facilitated PTEN transcription to inactivate AKT pathway. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Pancreatic cancer | ICD-11: 2C10 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Epithelial-mesenchymal transition | ||||
| Cell apoptosis | ||||
| In-vitro Model | BxPC-3 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0186 |
| CFPAC-1 | Cystic fibrosis | Homo sapiens | CVCL_1119 | |
| MIA PaCa-2 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0428 | |
| PANC-1 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0480 | |
Pancreatic cancer [ICD-11: 2C10]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | ALKBH5 inhibits pancreatic cancer motility by demethylating lncRNA KCNK15 and WISP2 antisense RNA 1 (KCNK15-AS1). | |||
| Responsed Disease | Pancreatic cancer [ICD-11: 2C10] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Epithelial-mesenchymal transition | |||
| Cell migration and invasion | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| BxPC-3 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0186 | |
| HPDE6c7 | Normal | Homo sapiens | CVCL_0P38 | |
| MIA PaCa-2 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0428 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | ALKBH5-mediated m6A demethylation enhanced the stability of KCNK15-AS1. In pancreatic cancer, KCNK15 and WISP2 antisense RNA 1 (KCNK15-AS1) bound to KCNK15 to inhibit its translation, and interacted with MDM2 to induce REST ubiquitination, which eventually facilitated PTEN transcription to inactivate AKT pathway. | |||
| Responsed Disease | Pancreatic cancer [ICD-11: 2C10] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Epithelial-mesenchymal transition | ||||
| Cell apoptosis | ||||
| In-vitro Model | BxPC-3 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0186 |
| CFPAC-1 | Cystic fibrosis | Homo sapiens | CVCL_1119 | |
| MIA PaCa-2 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0428 | |
| PANC-1 | Pancreatic ductal adenocarcinoma | Homo sapiens | CVCL_0480 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05376 | ||
| Epigenetic Regulator | KCNK15 and WISP2 antisense RNA 1 (KCNK15-AS1) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Pancreatic cancer | |
| Crosstalk ID: M6ACROT05543 | ||
| Epigenetic Regulator | KCNK15 and WISP2 antisense RNA 1 (KCNK15-AS1) | |
| Regulated Target | Potassium two pore domain channel subfamily K member 15 (KCNK15) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Pancreatic cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00082)
| In total 9 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE010635 | Click to Show/Hide the Full List | ||
| mod site | chr20:44704097-44704098:- | [3] | |
| Sequence | TGGCTCCTTGGCAGCACCATAGGAGACATAGCTGAACCATG | ||
| Transcript ID List | ENST00000445420.5; ENST00000427598.5 | ||
| External Link | RMBase: RNA-editing_site_87623 | ||
| mod ID: A2ISITE010636 | Click to Show/Hide the Full List | ||
| mod site | chr20:44707777-44707778:- | [3] | |
| Sequence | AGGGGCTGAGGCAGGAGGATACCTGAGCCTTGGGAAGCAGA | ||
| Transcript ID List | ENST00000427598.5; rmsk_5130314; ENST00000445420.5 | ||
| External Link | RMBase: RNA-editing_site_87624 | ||
| mod ID: A2ISITE010637 | Click to Show/Hide the Full List | ||
| mod site | chr20:44733993-44733994:- | [3] | |
| Sequence | GTAGGACTCAGCCTTATTTTACCCAGCCCCTACTCAAAATG | ||
| Transcript ID List | ENST00000445420.5; ENST00000427303.1; ENST00000427598.5 | ||
| External Link | RMBase: RNA-editing_site_87631 | ||
| mod ID: A2ISITE010638 | Click to Show/Hide the Full List | ||
| mod site | chr20:44735522-44735523:- | [3] | |
| Sequence | CTCGCCTTGAGTTCTTTCTTACGCGAGTTCCAAGATCCAGA | ||
| Transcript ID List | ENST00000427303.1; rmsk_5130401; ENST00000445420.5; ENST00000427598.5 | ||
| External Link | RMBase: RNA-editing_site_87632 | ||
| mod ID: A2ISITE010639 | Click to Show/Hide the Full List | ||
| mod site | chr20:44735547-44735548:- | [3] | |
| Sequence | AATAAATTCACTTTCACTTTATGGACTCGCCTTGAGTTCTT | ||
| Transcript ID List | ENST00000427303.1; ENST00000427598.5; rmsk_5130401; ENST00000445420.5 | ||
| External Link | RMBase: RNA-editing_site_87633 | ||
| mod ID: A2ISITE010640 | Click to Show/Hide the Full List | ||
| mod site | chr20:44736518-44736519:- | [3] | |
| Sequence | TGTGATAGCACATGAAATGTAGATAGACTACATTTCCCAGC | ||
| Transcript ID List | ENST00000427598.5; ENST00000427303.1; ENST00000445420.5; rmsk_5130403 | ||
| External Link | RMBase: RNA-editing_site_87634 | ||
| mod ID: A2ISITE010641 | Click to Show/Hide the Full List | ||
| mod site | chr20:44736826-44736827:- | [3] | |
| Sequence | ATGGCCACACCTAGCTGCAAAGGAGACTGGGAAATGTAGTC | ||
| Transcript ID List | ENST00000427303.1; ENST00000427598.5; ENST00000445420.5 | ||
| External Link | RMBase: RNA-editing_site_87635 | ||
| mod ID: A2ISITE010642 | Click to Show/Hide the Full List | ||
| mod site | chr20:44736858-44736859:- | [3] | |
| Sequence | CCTTCATATTTTATTGGTAAAGATTGAGTCACATGGCCACA | ||
| Transcript ID List | ENST00000427303.1; ENST00000445420.5; ENST00000427598.5 | ||
| External Link | RMBase: RNA-editing_site_87636 | ||
| mod ID: A2ISITE010643 | Click to Show/Hide the Full List | ||
| mod site | chr20:44737085-44737086:- | [3] | |
| Sequence | CCTAGCGAATCAGGAACTTTAGGTGTGGGGCCCAGCCATCT | ||
| Transcript ID List | ENST00000427303.1; ENST00000427598.5; ENST00000445420.5; rmsk_5130405 | ||
| External Link | RMBase: RNA-editing_site_87637 | ||
N6-methyladenosine (m6A)
| In total 17 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE053063 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695250-44695251:- | [4] | |
| Sequence | TTTGGGGATGACTTCAGGGAACCCTGAATAGCCATGGGAGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; H1A; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000415889.2; ENST00000419931.1; ENST00000427598.5 | ||
| External Link | RMBase: m6A_site_533113 | ||
| mod ID: M6ASITE053064 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695284-44695285:- | [4] | |
| Sequence | CAACCTTGGTGACAGGCTGGACTGGCAGCCAGCTTTTGGGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; H1A; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000419931.1; ENST00000427598.5; ENST00000415889.2 | ||
| External Link | RMBase: m6A_site_533114 | ||
| mod ID: M6ASITE053065 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695305-44695306:- | [4] | |
| Sequence | AGGGTAAAGCCATCACCAGGACAACCTTGGTGACAGGCTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; H1A; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000419931.1; ENST00000427598.5; ENST00000415889.2; ENST00000445420.5 | ||
| External Link | RMBase: m6A_site_533115 | ||
| mod ID: M6ASITE053066 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695365-44695366:- | [4] | |
| Sequence | GCCAAACTTCCTCCCTCAGGACCATCCACTCCAGGGCCCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; H1A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000419931.1; ENST00000415889.2; ENST00000445420.5; ENST00000427598.5 | ||
| External Link | RMBase: m6A_site_533116 | ||
| mod ID: M6ASITE053067 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695380-44695381:- | [4] | |
| Sequence | TGCTTTATCAAGTGAGCCAAACTTCCTCCCTCAGGACCATC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000419931.1; ENST00000427598.5; ENST00000415889.2 | ||
| External Link | RMBase: m6A_site_533117 | ||
| mod ID: M6ASITE053068 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695461-44695462:- | [4] | |
| Sequence | TATCCTCCCAGGACCACAGAACTCATCGCATCCCAAGGCAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000419931.1; ENST00000415889.2; ENST00000427598.5 | ||
| External Link | RMBase: m6A_site_533118 | ||
| mod ID: M6ASITE053069 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695469-44695470:- | [4] | |
| Sequence | TCTGCTTGTATCCTCCCAGGACCACAGAACTCATCGCATCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415889.2; ENST00000427598.5; ENST00000445420.5; ENST00000419931.1 | ||
| External Link | RMBase: m6A_site_533119 | ||
| mod ID: M6ASITE053070 | Click to Show/Hide the Full List | ||
| mod site | chr20:44695495-44695496:- | [4] | |
| Sequence | TCCTTGCAGGTGGCCACCAGACTTTCTCTGCTTGTATCCTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000419931.1; ENST00000415889.2; ENST00000427598.5 | ||
| External Link | RMBase: m6A_site_533120 | ||
| mod ID: M6ASITE053071 | Click to Show/Hide the Full List | ||
| mod site | chr20:44696004-44696005:- | [4] | |
| Sequence | TGAATTTCCCAACCTCCAGAACTGTGAGCAATGAATTTCTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000419931.1; ENST00000415889.2; ENST00000445420.5; ENST00000427598.5; rmsk_5130281 | ||
| External Link | RMBase: m6A_site_533121 | ||
| mod ID: M6ASITE053072 | Click to Show/Hide the Full List | ||
| mod site | chr20:44696051-44696052:- | [4] | |
| Sequence | AAGAAACAGGCTCCCACCAGACACTGAGTCTGCTGGAGCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415889.2; rmsk_5130281; ENST00000445420.5; ENST00000427598.5; ENST00000419931.1 | ||
| External Link | RMBase: m6A_site_533122 | ||
| mod ID: M6ASITE053073 | Click to Show/Hide the Full List | ||
| mod site | chr20:44696066-44696067:- | [4] | |
| Sequence | GAAGTCACCATCTATAAGAAACAGGCTCCCACCAGACACTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000427598.5; ENST00000445420.5; ENST00000419931.1; rmsk_5130281; ENST00000415889.2 | ||
| External Link | RMBase: m6A_site_533123 | ||
| mod ID: M6ASITE053074 | Click to Show/Hide the Full List | ||
| mod site | chr20:44696093-44696094:- | [4] | |
| Sequence | GTCCCTTCTGCCATGTGAGGACACACAGAAGTCACCATCTA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000415889.2; ENST00000445420.5; rmsk_5130281; ENST00000427598.5 | ||
| External Link | RMBase: m6A_site_533124 | ||
| mod ID: M6ASITE053075 | Click to Show/Hide the Full List | ||
| mod site | chr20:44716731-44716732:- | [4] | |
| Sequence | GCCAACGGCCAGCCTGGAAGACTTACAGTTCTCCCTCTGAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000427598.5; ENST00000445420.5; ENST00000427303.1 | ||
| External Link | RMBase: m6A_site_533133 | ||
| mod ID: M6ASITE053076 | Click to Show/Hide the Full List | ||
| mod site | chr20:44738843-44738844:- | [4] | |
| Sequence | GGAAATCTCTCCAACCAGGAACAAACACCTGCCTTGCAATA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000427598.5; ENST00000445420.5; rmsk_5130411; ENST00000427303.1 | ||
| External Link | RMBase: m6A_site_533150 | ||
| mod ID: M6ASITE053077 | Click to Show/Hide the Full List | ||
| mod site | chr20:44738924-44738925:- | [4] | |
| Sequence | TGTCTGTCTAGATGCAGAGAACCCAAAGCCCTGCAGGATGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000427303.1; rmsk_5130411 | ||
| External Link | RMBase: m6A_site_533151 | ||
| mod ID: M6ASITE053078 | Click to Show/Hide the Full List | ||
| mod site | chr20:44745983-44745984:- | [4] | |
| Sequence | CGGACTCGAGCGCGTCGAAGACAGCAGCGCCCACCAGCAGG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000445420.5; ENST00000427303.1 | ||
| External Link | RMBase: m6A_site_533152 | ||
| mod ID: M6ASITE053079 | Click to Show/Hide the Full List | ||
| mod site | chr20:44746000-44746001:- | [4] | |
| Sequence | GCGGCCGCTTTCCGCCTCGGACTCGAGCGCGTCGAAGACAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000427303.1 | ||
| External Link | RMBase: m6A_site_533153 | ||
References