m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00080)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LNCAROD
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Caco-2 cell line | Homo sapiens |
|
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
|
GSE167075 | |
| Regulation |
![]() ![]() |
logFC: 9.04E-01 p-value: 2.47E-45 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between LNCAROD and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 5.11E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Head and neck squamous carcinoma | ICD-11: 2B6E | ||
| Pathway Response | Proteasome | hsa03050 | ||
| Cell Process | Proteasomal degradation | |||
| In-vitro Model | C666-1 | Nasopharyngeal carcinoma | Homo sapiens | CVCL_7949 |
| CAL-27 | Tongue squamous cell carcinoma | Homo sapiens | CVCL_1107 | |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| HK1 | Nasopharyngeal carcinoma | Acipenser baerii | CVCL_YE27 | |
| NP69 (A human immortalized nasopharyngeal epithelial) | ||||
| Tca8113 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6851 | |
Methyltransferase-like 14 (METTL14) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Head and neck squamous carcinoma | ICD-11: 2B6E | ||
| Pathway Response | Proteasome | hsa03050 | ||
| Cell Process | Proteasomal degradation | |||
| In-vitro Model | C666-1 | Nasopharyngeal carcinoma | Homo sapiens | CVCL_7949 |
| CAL-27 | Tongue squamous cell carcinoma | Homo sapiens | CVCL_1107 | |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| HK1 | Nasopharyngeal carcinoma | Acipenser baerii | CVCL_YE27 | |
| NP69 (A human immortalized nasopharyngeal epithelial) | ||||
| Tca8113 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6851 | |
Head and neck squamous carcinoma [ICD-11: 2B6E]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma. | |||
| Responsed Disease | Head and neck squamous carcinoma [ICD-11: 2B6E] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Proteasome | hsa03050 | ||
| Cell Process | Proteasomal degradation | |||
| In-vitro Model | C666-1 | Nasopharyngeal carcinoma | Homo sapiens | CVCL_7949 |
| CAL-27 | Tongue squamous cell carcinoma | Homo sapiens | CVCL_1107 | |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| HK1 | Nasopharyngeal carcinoma | Acipenser baerii | CVCL_YE27 | |
| NP69 (A human immortalized nasopharyngeal epithelial) | ||||
| Tca8113 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6851 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma. | |||
| Responsed Disease | Head and neck squamous carcinoma [ICD-11: 2B6E] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Proteasome | hsa03050 | ||
| Cell Process | Proteasomal degradation | |||
| In-vitro Model | C666-1 | Nasopharyngeal carcinoma | Homo sapiens | CVCL_7949 |
| CAL-27 | Tongue squamous cell carcinoma | Homo sapiens | CVCL_1107 | |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| HK1 | Nasopharyngeal carcinoma | Acipenser baerii | CVCL_YE27 | |
| NP69 (A human immortalized nasopharyngeal epithelial) | ||||
| Tca8113 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6851 | |
Liver cancer [ICD-11: 2C12]
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05425 | ||
| Epigenetic Regulator | LncRNA activating regulator of DKK1 (LNCAROD) | |
| Regulated Target | Y-box-binding protein 1 (YBX1) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Head and neck squamous carcinoma | |
m6A Regulator: Methyltransferase-like 14 (METTL14)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05426 | ||
| Epigenetic Regulator | LncRNA activating regulator of DKK1 (LNCAROD) | |
| Regulated Target | Heat shock 70 kDa protein 1A (HSPA1A) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Head and neck squamous carcinoma | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00080)
| In total 13 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE000045 | Click to Show/Hide the Full List | ||
| mod site | chr10:52451396-52451397:- | [2] | |
| Sequence | ACTGAGACAACTCCAGTGGAACTCTGATAATTATCCTAAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000647908.1; ENST00000435813.6; ENST00000422763.1 | ||
| External Link | RMBase: m6A_site_101262 | ||
| mod ID: M6ASITE000046 | Click to Show/Hide the Full List | ||
| mod site | chr10:52451410-52451411:- | [2] | |
| Sequence | ATGGAACTTCCTACACTGAGACAACTCCAGTGGAACTCTGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000435813.6; ENST00000647908.1; ENST00000422763.1 | ||
| External Link | RMBase: m6A_site_101263 | ||
| mod ID: M6ASITE000047 | Click to Show/Hide the Full List | ||
| mod site | chr10:52451425-52451426:- | [2] | |
| Sequence | CTACGAAGACTAGCTATGGAACTTCCTACACTGAGACAACT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000435813.6; ENST00000422763.1; ENST00000647908.1 | ||
| External Link | RMBase: m6A_site_101264 | ||
| mod ID: M6ASITE000048 | Click to Show/Hide the Full List | ||
| mod site | chr10:52451437-52451438:- | [2] | |
| Sequence | GATAACCCCAATCTACGAAGACTAGCTATGGAACTTCCTAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000647908.1; ENST00000435813.6; ENST00000422763.1 | ||
| External Link | RMBase: m6A_site_101265 | ||
| mod ID: M6ASITE000049 | Click to Show/Hide the Full List | ||
| mod site | chr10:52451463-52451464:- | [2] | |
| Sequence | TGTGACCCCCAAGTTTGAAGACTGCTGATAACCCCAATCTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000422763.1; ENST00000647908.1; ENST00000435813.6 | ||
| External Link | RMBase: m6A_site_101266 | ||
| mod ID: M6ASITE000050 | Click to Show/Hide the Full List | ||
| mod site | chr10:52454614-52454615:- | [2] | |
| Sequence | AGGAAGAGCCAGCAAAGGAGACTGAGAAGGGGCAGCCAGTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000647908.1; ENST00000435813.6; ENST00000422763.1 | ||
| External Link | RMBase: m6A_site_101267 | ||
| mod ID: M6ASITE000051 | Click to Show/Hide the Full List | ||
| mod site | chr10:52454645-52454646:- | [2] | |
| Sequence | CCTGAGACACTCCATTGTAAACTGGAAGATGAGGAAGAGCC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000647908.1; ENST00000422763.1; ENST00000435813.6 | ||
| External Link | RMBase: m6A_site_101268 | ||
| mod ID: M6ASITE000052 | Click to Show/Hide the Full List | ||
| mod site | chr10:52454659-52454660:- | [2] | |
| Sequence | TCTGAAGACGGAGCCCTGAGACACTCCATTGTAAACTGGAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000435813.6; ENST00000422763.1; ENST00000647908.1 | ||
| External Link | RMBase: m6A_site_101269 | ||
| mod ID: M6ASITE000053 | Click to Show/Hide the Full List | ||
| mod site | chr10:52454728-52454729:- | [2] | |
| Sequence | ATGTTGTTTGAAGCCGTGAGACTGAGTGAGATCATGGAGGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000422763.1; ENST00000435813.6; ENST00000647908.1 | ||
| External Link | RMBase: m6A_site_101270 | ||
| mod ID: M6ASITE000054 | Click to Show/Hide the Full List | ||
| mod site | chr10:52455116-52455117:- | [2] | |
| Sequence | TGAGGATTGTCTGAAGGGGAACAAAGGCCAAGGTGGGGAGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000422763.1; ENST00000647908.1; ENST00000435813.6 | ||
| External Link | RMBase: m6A_site_101271 | ||
| mod ID: M6ASITE000055 | Click to Show/Hide the Full List | ||
| mod site | chr10:52455152-52455153:- | [2] | |
| Sequence | TGGCTTAGGGTTTAGAAGGAACACAGGCTACTGCGATGAGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000435813.6; ENST00000422763.1; ENST00000647908.1 | ||
| External Link | RMBase: m6A_site_101272 | ||
| mod ID: M6ASITE000056 | Click to Show/Hide the Full List | ||
| mod site | chr10:52455180-52455181:- | [2] | |
| Sequence | CGGTGCTGAGCAGGGAAGAGACAGGCTCTGGCTTAGGGTTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000435813.6; ENST00000422763.1; ENST00000647908.1 | ||
| External Link | RMBase: m6A_site_101273 | ||
| mod ID: M6ASITE000057 | Click to Show/Hide the Full List | ||
| mod site | chr10:52455210-52455211:- | [3] | |
| Sequence | GAGGGCCTGAGTCCTTGTAGACTCTGAGTACGGTGCTGAGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000422763.1; ENST00000435813.6; ENST00000647908.1 | ||
| External Link | RMBase: m6A_site_101274 | ||
References

