m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00080)
Target Name LncRNA activating regulator of DKK1 (LNCAROD)
Synonyms
LNCAROD; LINC01468; long intergenic non-protein coding RNA 1468; lnc-MBL2-4; A-ROD; Activating Regulator of DKK1
    Click to Show/Hide
Gene Name LNCAROD
Chromosomal Location 10q21.1
Family Long non-coding RNAs with non-systematic symbols
Gene ID 101928687
HGNC ID
HGNC:50913
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LNCAROD can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
 GSE167075
Regulation
logFC: 9.04E-01
p-value: 2.47E-45
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between LNCAROD and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 5.11E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma.
Target Regulation Up regulation
Responsed Disease Head and neck squamous carcinoma ICD-11: 2B6E
 Disease Info 
Pathway Response Proteasome hsa03050
Cell Process Proteasomal degradation
In-vitro Model C666-1 Nasopharyngeal carcinoma Homo sapiens CVCL_7949
CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
FaDu Hypopharyngeal squamous cell carcinoma Homo sapiens CVCL_1218
HK1 Nasopharyngeal carcinoma Acipenser baerii CVCL_YE27
NP69 (A human immortalized nasopharyngeal epithelial)
Tca8113 Endocervical adenocarcinoma Homo sapiens CVCL_6851
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma.
Target Regulation Up regulation
Responsed Disease Head and neck squamous carcinoma ICD-11: 2B6E
 Disease Info 
Pathway Response Proteasome hsa03050
Cell Process Proteasomal degradation
In-vitro Model C666-1 Nasopharyngeal carcinoma Homo sapiens CVCL_7949
CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
FaDu Hypopharyngeal squamous cell carcinoma Homo sapiens CVCL_1218
HK1 Nasopharyngeal carcinoma Acipenser baerii CVCL_YE27
NP69 (A human immortalized nasopharyngeal epithelial)
Tca8113 Endocervical adenocarcinoma Homo sapiens CVCL_6851
Head and neck squamous carcinoma [ICD-11: 2B6E]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma.
Responsed Disease Head and neck squamous carcinoma [ICD-11: 2B6E]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Proteasome hsa03050
Cell Process Proteasomal degradation
In-vitro Model C666-1 Nasopharyngeal carcinoma Homo sapiens CVCL_7949
CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
FaDu Hypopharyngeal squamous cell carcinoma Homo sapiens CVCL_1218
HK1 Nasopharyngeal carcinoma Acipenser baerii CVCL_YE27
NP69 (A human immortalized nasopharyngeal epithelial)
Tca8113 Endocervical adenocarcinoma Homo sapiens CVCL_6851
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary The N6-methyladenosine (m6A) modification mediated by METTL3 and METTL14 enhanced the stability of LncRNA activating regulator of DKK1 (LNCAROD) in head and neck squamous cell carcinoma cells. LNCAROD is stabilized by m6A methylation and promotes cancer progression via forming a ternary complex with HSPA1A and YBX1 in head and neck squamous cell carcinoma.
Responsed Disease Head and neck squamous carcinoma [ICD-11: 2B6E]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Proteasome hsa03050
Cell Process Proteasomal degradation
In-vitro Model C666-1 Nasopharyngeal carcinoma Homo sapiens CVCL_7949
CAL-27 Tongue squamous cell carcinoma Homo sapiens CVCL_1107
FaDu Hypopharyngeal squamous cell carcinoma Homo sapiens CVCL_1218
HK1 Nasopharyngeal carcinoma Acipenser baerii CVCL_YE27
NP69 (A human immortalized nasopharyngeal epithelial)
Tca8113 Endocervical adenocarcinoma Homo sapiens CVCL_6851
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary LncRNA activating regulator of DKK1 (LNCAROD) induces PKM2 upregulation via simultaneously enhancing SRSF3-mediated PKM switching to PKM2 and sponging miR-145-5p to increase PKM2 level, eventually increasing hepatocellular carcinoma cell aerobic glycolysis to participate in tumor malignancy and chemoresistance, especially under hypoxic microenvironment.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Pathway Response Glycolysis / Gluconeogenesis hsa00010
Cell Process Aerobic glycolysis
In-vitro Model ()
()
()
()
()
()
()
In-vivo Model HCC-LM3 cells with silenced LNCAROD or the negative control were subcutaneously injected into the flank region of the mice at 2 × 106 cells.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05425
 Crosstalk Info 
Epigenetic Regulator LncRNA activating regulator of DKK1 (LNCAROD)
Regulated Target Y-box-binding protein 1 (YBX1)
Crosstalk relationship m6A → ncRNA
Disease Head and neck squamous carcinoma
 Disease Info 
m6A Regulator: Methyltransferase-like 14 (METTL14)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05426
 Crosstalk Info 
Epigenetic Regulator LncRNA activating regulator of DKK1 (LNCAROD)
Regulated Target Heat shock 70 kDa protein 1A (HSPA1A)
Crosstalk relationship m6A → ncRNA
Disease Head and neck squamous carcinoma
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00080)
LncRNA activating regulator of DKK1 (LNCAROD)
N6-methyladenosine (m6A)
In total 13 m6A sequence/site(s) in this target gene
mod ID: M6ASITE000045 Click to Show/Hide the Full List
mod site chr10:52451396-52451397:- [2]
Sequence ACTGAGACAACTCCAGTGGAACTCTGATAATTATCCTAAAA
Motif Score 3.373380952
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000647908.1; ENST00000435813.6; ENST00000422763.1
External Link RMBase: m6A_site_101262
mod ID: M6ASITE000046 Click to Show/Hide the Full List
mod site chr10:52451410-52451411:- [2]
Sequence ATGGAACTTCCTACACTGAGACAACTCCAGTGGAACTCTGA
Motif Score 2.897386905
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435813.6; ENST00000647908.1; ENST00000422763.1
External Link RMBase: m6A_site_101263
mod ID: M6ASITE000047 Click to Show/Hide the Full List
mod site chr10:52451425-52451426:- [2]
Sequence CTACGAAGACTAGCTATGGAACTTCCTACACTGAGACAACT
Motif Score 3.373380952
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435813.6; ENST00000422763.1; ENST00000647908.1
External Link RMBase: m6A_site_101264
mod ID: M6ASITE000048 Click to Show/Hide the Full List
mod site chr10:52451437-52451438:- [2]
Sequence GATAACCCCAATCTACGAAGACTAGCTATGGAACTTCCTAC
Motif Score 3.319380952
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000647908.1; ENST00000435813.6; ENST00000422763.1
External Link RMBase: m6A_site_101265
mod ID: M6ASITE000049 Click to Show/Hide the Full List
mod site chr10:52451463-52451464:- [2]
Sequence TGTGACCCCCAAGTTTGAAGACTGCTGATAACCCCAATCTA
Motif Score 3.319380952
Cell/Tissue List A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000422763.1; ENST00000647908.1; ENST00000435813.6
External Link RMBase: m6A_site_101266
mod ID: M6ASITE000050 Click to Show/Hide the Full List
mod site chr10:52454614-52454615:- [2]
Sequence AGGAAGAGCCAGCAAAGGAGACTGAGAAGGGGCAGCCAGTG
Motif Score 3.319380952
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000647908.1; ENST00000435813.6; ENST00000422763.1
External Link RMBase: m6A_site_101267
mod ID: M6ASITE000051 Click to Show/Hide the Full List
mod site chr10:52454645-52454646:- [2]
Sequence CCTGAGACACTCCATTGTAAACTGGAAGATGAGGAAGAGCC
Motif Score 2.627720238
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000647908.1; ENST00000422763.1; ENST00000435813.6
External Link RMBase: m6A_site_101268
mod ID: M6ASITE000052 Click to Show/Hide the Full List
mod site chr10:52454659-52454660:- [2]
Sequence TCTGAAGACGGAGCCCTGAGACACTCCATTGTAAACTGGAA
Motif Score 2.897386905
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000435813.6; ENST00000422763.1; ENST00000647908.1
External Link RMBase: m6A_site_101269
mod ID: M6ASITE000053 Click to Show/Hide the Full List
mod site chr10:52454728-52454729:- [2]
Sequence ATGTTGTTTGAAGCCGTGAGACTGAGTGAGATCATGGAGGA
Motif Score 3.319380952
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000422763.1; ENST00000435813.6; ENST00000647908.1
External Link RMBase: m6A_site_101270
mod ID: M6ASITE000054 Click to Show/Hide the Full List
mod site chr10:52455116-52455117:- [2]
Sequence TGAGGATTGTCTGAAGGGGAACAAAGGCCAAGGTGGGGAGA
Motif Score 2.951386905
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000422763.1; ENST00000647908.1; ENST00000435813.6
External Link RMBase: m6A_site_101271
mod ID: M6ASITE000055 Click to Show/Hide the Full List
mod site chr10:52455152-52455153:- [2]
Sequence TGGCTTAGGGTTTAGAAGGAACACAGGCTACTGCGATGAGG
Motif Score 2.951386905
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000435813.6; ENST00000422763.1; ENST00000647908.1
External Link RMBase: m6A_site_101272
mod ID: M6ASITE000056 Click to Show/Hide the Full List
mod site chr10:52455180-52455181:- [2]
Sequence CGGTGCTGAGCAGGGAAGAGACAGGCTCTGGCTTAGGGTTT
Motif Score 2.897386905
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000435813.6; ENST00000422763.1; ENST00000647908.1
External Link RMBase: m6A_site_101273
mod ID: M6ASITE000057 Click to Show/Hide the Full List
mod site chr10:52455210-52455211:- [3]
Sequence GAGGGCCTGAGTCCTTGTAGACTCTGAGTACGGTGCTGAGC
Motif Score 3.319380952
Cell/Tissue List HeLa; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000422763.1; ENST00000435813.6; ENST00000647908.1
External Link RMBase: m6A_site_101274