m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00056)
Target Name hsa-miR-140-3p
Gene Name hsa-miR-140-3p
miRBase ID
MIMAT0004597
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
hsa-miR-140-3p can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3/SNHG1/hsa-miR-140-3p/UBE2C axis plays a crucial role in cancer progression and the immune response in non-small cell lung cancer.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
BEAS-2B Normal Homo sapiens CVCL_0168
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3/SNHG1/hsa-miR-140-3p/UBE2C axis plays a crucial role in cancer progression and the immune response in non-small cell lung cancer.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
BEAS-2B Normal Homo sapiens CVCL_0168
NCI-H1299 Lung large cell carcinoma Homo sapiens CVCL_0060
NCI-H1975 Lung adenocarcinoma Homo sapiens CVCL_1511
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05544
 Crosstalk Info 
Epigenetic Regulator hsa-miR-140-3p
Regulated Target Ubiquitin-conjugating enzyme E2 C (UBE2C)
Crosstalk relationship m6A → ncRNA
Disease Non-small cell lung cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00056)
hsa-miR-140-3p
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE028304 Click to Show/Hide the Full List
mod site chr16:69933155-69933156:+ [2]
Sequence CTGTTCTACCACAGGGTAGAACCACGGACAGGATACCGGGG
Motif Score 2.930744048
Cell/Tissue List BGC823
Seq Type List m6A-seq
Transcript ID List ENST00000566463.5; ENST00000544162.5; ENST00000568684.1; ENST00000569297.5; MIMAT0004597; ENST00000356003.6; ENST00000359154.6; ENST00000568818.1; ENST00000385282.3
External Link RMBase: m6A_site_328684