m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00040)
Target Name hsa-miR-199a-5p
Gene Name hsa-miR-199a-5p
miRBase ID
MIMAT0000231
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
hsa-miR-199a-5p can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3-mediated circNRIP1 exhibits oncogenic roles in osteosarcoma by regulating FOXC2 via sponging hsa-miR-199a-5p, which provides new ideas for the treatment of osteosarcoma.
Target Regulation Up regulation
Responsed Disease Osteosarcoma ICD-11: 2B51
 Disease Info 
Cell Process Cell apoptosis
In-vitro Model hFOB 1.19 Normal Homo sapiens CVCL_3708
MG-63 Osteosarcoma Homo sapiens CVCL_0426
U2OS Osteosarcoma Homo sapiens CVCL_0042
Osteosarcoma [ICD-11: 2B51]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3-mediated circNRIP1 exhibits oncogenic roles in osteosarcoma by regulating FOXC2 via sponging hsa-miR-199a-5p, which provides new ideas for the treatment of osteosarcoma.
Responsed Disease Osteosarcoma [ICD-11: 2B51]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Cell apoptosis
In-vitro Model hFOB 1.19 Normal Homo sapiens CVCL_3708
MG-63 Osteosarcoma Homo sapiens CVCL_0426
U2OS Osteosarcoma Homo sapiens CVCL_0042
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00040)
hsa-miR-199a-5p
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE067096 Click to Show/Hide the Full List
mod site chr1:172144601-172144602:- [2]
Sequence TCCGTCGCCCCAGTGTTCAGACTACCTGTTCAGGACAATGC
Motif Score 3.319380952
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000417354.3; ENST00000385289.1; MIMAT0000231; ENST00000650189.1; ENST00000648909.1
External Link RMBase: m6A_site_64744