m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00713)

Target Name	DNA repair protein RAD51 homolog 1 (RAD51)
Synonyms	HsRAD51; hRAD51; RAD51 homolog A Click to Show/Hide
Gene Name	RAD51
Chromosomal Location	15q15.1
Family	RecA family, RAD51 subfamily
Function	Plays an important role in homologous strand exchange, a key step in DNA repair through homologous recombination (HR). Binds to single and double-stranded DNA and exhibits DNA-dependent ATPase activity. Catalyzes the recognition of homology and strand exchange between homologous DNA partners to form a joint molecule between a processed DNA break and the repair template. Binds to single-stranded DNA in an ATP-dependent manner to form nucleoprotein filaments which are essential for the homology search and strand exchange. Part of a PALB2-scaffolded HR complex containing BRCA2 and RAD51C and which is thought to play a role in DNA repair by HR. Plays a role in regulating mitochondrial DNA copy number under conditions of oxidative stress in the presence of RAD51C and XRCC3. Also involved in interstrand cross-link repair. Click to Show/Hide
Gene ID	5888
Uniprot ID	RAD51_HUMAN
HGNC ID	HGNC:9817
KEGG ID	hsa:5888

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

RAD51 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HeLa cell line	Homo sapiens
Treatment: METTL3 knockdown HeLa cells Control: HeLa cells		GSE70061
Regulation		logFC: 2.32E+00 p-value: 1.62E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL3 sensitized these breast cancer cells to Adriamycin (ADR; also named as doxorubicin) treatment and increased accumulation of DNA damage. Mechanically, we demonstrated that inhibition of METTL3 impaired HR efficiency and increased ADR-induced DNA damage by regulating m6A modification of EGF/RAD51 axis. METTL3 promoted EGF expression through m6A modification, which further upregulated DNA repair protein RAD51 homolog 1 (RAD51) expression, resulting in enhanced HR activity.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Homologous recombination			hsa03440
Cell Process	Homologous recombination repair
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Cells were trypsinized and resuspended in DMEM at a consistence of 1 × 10⁷ cells/ml. A total of 1 × 10⁶ cells were injected into flank of mice. 27 days after injection, tumors were removed for paraffin-embedded sections.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL3 sensitized these breast cancer cells to Adriamycin (ADR; also named as doxorubicin) treatment and increased accumulation of DNA damage. Mechanically, we demonstrated that inhibition of METTL3 impaired HR efficiency and increased ADR-induced DNA damage by regulating m6A modification of EGF/RAD51 axis. METTL3 promoted EGF expression through m6A modification, which further upregulated DNA repair protein RAD51 homolog 1 (RAD51) expression, resulting in enhanced HR activity.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
Pathway Response	Homologous recombination			hsa03440
Cell Process	Homologous recombination repair
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Cells were trypsinized and resuspended in DMEM at a consistence of 1 × 10⁷ cells/ml. A total of 1 × 10⁶ cells were injected into flank of mice. 27 days after injection, tumors were removed for paraffin-embedded sections.

Doxil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Knockdown of METTL3 sensitized these breast cancer cells to Adriamycin (ADR; also named as doxorubicin) treatment and increased accumulation of DNA damage. Mechanically, we demonstrated that inhibition of METTL3 impaired HR efficiency and increased ADR-induced DNA damage by regulating m6A modification of EGF/RAD51 axis. METTL3 promoted EGF expression through m6A modification, which further upregulated DNA repair protein RAD51 homolog 1 (RAD51) expression, resulting in enhanced HR activity.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Pathway Response	Homologous recombination			hsa03440
Cell Process	Homologous recombination repair
In-vitro Model	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vivo Model	Cells were trypsinized and resuspended in DMEM at a consistence of 1 × 10⁷ cells/ml. A total of 1 × 10⁶ cells were injected into flank of mice. 27 days after injection, tumors were removed for paraffin-embedded sections.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00713)

DNA repair protein RAD51 homolog 1 (RAD51)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006763		Click to Show/Hide the Full List
mod site	chr15:40706533-40706534:+		[3]
Sequence	TGGAGAAACCTATTAAAAATACAAAATTAGTTGGGCATGGT
Transcript ID List	ENST00000527860.5; rmsk_4315952; ENST00000531277.2; ENST00000525066.5; ENST00000423169.6; ENST00000532743.6; ENST00000267868.8; ENST00000382643.7; ENST00000645673.2; ENST00000557850.5; ENST00000533741.1
External Link	RMBase: RNA-editing_site_42465
mod ID: A2ISITE006764		Click to Show/Hide the Full List
mod site	chr15:40719822-40719823:+		[3]
Sequence	GCCTGGGCGACAGAGCAAGAATCCGTCTCAAAAAAAAAAGA
Transcript ID List	ENST00000382643.7; ENST00000532743.6; ENST00000531277.2; ENST00000267868.8; rmsk_4315988; ENST00000645673.2; ENST00000525066.5; ENST00000423169.6; ENST00000557850.5
External Link	RMBase: RNA-editing_site_42475
mod ID: A2ISITE006765		Click to Show/Hide the Full List
mod site	chr15:40730317-40730318:+		[3]
Sequence	CCAGGAATTCGACACTAGTAAGGGCAACAAAGTGAGGCCTC
Transcript ID List	rmsk_4316021; ENST00000423169.6; ENST00000532743.6; ENST00000525066.5; ENST00000267868.8; ENST00000557850.5; ENST00000645673.2; ENST00000382643.7
External Link	RMBase: RNA-editing_site_42476
mod ID: A2ISITE006766		Click to Show/Hide the Full List
mod site	chr15:40732001-40732002:+		[4]
Sequence	CTGAGGTGGGAGAATCACTTAAGCCTGGAAGGTGGAAGTTG
Transcript ID List	ENST00000267868.8; rmsk_4316023; ENST00000645673.2
External Link	RMBase: RNA-editing_site_42477

N6-methyladenosine (m6A)

In total 18 m6A sequence/site(s) in this target gene
mod ID: M6ASITE022440		Click to Show/Hide the Full List
mod site	chr15:40695194-40695195:+		[5]
Sequence	ATTCTGAAAGCCGCTGGCGGACCGCGCGCAGCGGCCAGAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; H1B; A549; MT4; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000557850.5; ENST00000525066.5; ENST00000423169.6; ENST00000382643.7; ENST00000267868.8; ENST00000645673.2; ENST00000527860.5
External Link	RMBase: m6A_site_271729
mod ID: M6ASITE022441		Click to Show/Hide the Full List
mod site	chr15:40695214-40695215:+		[5]
Sequence	ACCGCGCGCAGCGGCCAGAGACCGAGCCCTAAGGAGAGTGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; MT4; MM6; Jurkat; peripheral-blood; GSC-11; HEK293T; TIME; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000557850.5; ENST00000423169.6; ENST00000382643.7; ENST00000267868.8; ENST00000527860.5; ENST00000525066.5; ENST00000645673.2
External Link	RMBase: m6A_site_271730
mod ID: M6ASITE022442		Click to Show/Hide the Full List
mod site	chr15:40695262-40695263:+		[5]
Sequence	CCCGAGGCGTGCAGCTGGGAACTGCAACTCATCTGGGTTGT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; U2OS; A549; MT4; MM6; Jurkat; peripheral-blood; GSC-11; HEK293T; TIME; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000423169.6; ENST00000525066.5; ENST00000557850.5; ENST00000267868.8; ENST00000645673.2; ENST00000527860.5; ENST00000382643.7
External Link	RMBase: m6A_site_271731
mod ID: M6ASITE022443		Click to Show/Hide the Full List
mod site	chr15:40695419-40695420:+		[5]
Sequence	TGGAGAGAGGAGCGCTGCGGACCGAGGTGAGTGTGTGAGGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; MT4; H1299; peripheral-blood; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000382643.7; ENST00000557850.5; ENST00000645673.2; ENST00000527860.5; ENST00000525066.5; ENST00000267868.8; ENST00000423169.6
External Link	RMBase: m6A_site_271732
mod ID: M6ASITE022444		Click to Show/Hide the Full List
mod site	chr15:40718844-40718845:+		[6]
Sequence	AGGTGAAGGAAAGGCCATGTACATTGACACTGAGGGTACCT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000557850.5; ENST00000525066.5; ENST00000423169.6; ENST00000267868.8; ENST00000527860.5; ENST00000645673.2; ENST00000382643.7; ENST00000532743.6; ENST00000531277.2
External Link	RMBase: m6A_site_271733
mod ID: M6ASITE022445		Click to Show/Hide the Full List
mod site	chr15:40718850-40718851:+		[6]
Sequence	AGGAAAGGCCATGTACATTGACACTGAGGGTACCTTTAGGC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000531277.2; ENST00000267868.8; ENST00000423169.6; ENST00000557850.5; ENST00000532743.6; ENST00000527860.5; ENST00000645673.2; ENST00000525066.5; ENST00000382643.7
External Link	RMBase: m6A_site_271734
mod ID: M6ASITE022446		Click to Show/Hide the Full List
mod site	chr15:40728766-40728767:+		[6]
Sequence	AGCATATGCTCGAGCGTTCAACACAGACCACCAGACCCAGC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000645673.2; ENST00000557850.5; ENST00000267868.8; ENST00000382643.7; ENST00000423169.6; ENST00000531277.2; ENST00000532743.6; ENST00000525066.5
External Link	RMBase: m6A_site_271735
mod ID: M6ASITE022447		Click to Show/Hide the Full List
mod site	chr15:40729932-40729933:+		[5]
Sequence	TTTGCTGCTGATCCCAAAAAACCTATTGGAGGAAATATCAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000525066.5; ENST00000382643.7; ENST00000645673.2; ENST00000532743.6; ENST00000557850.5; ENST00000423169.6; ENST00000267868.8
External Link	RMBase: m6A_site_271736
mod ID: M6ASITE022448		Click to Show/Hide the Full List
mod site	chr15:40729966-40729967:+		[6]
Sequence	ATATCATCGCCCATGCATCAACAACCAGGTAAGGTGTTGAT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000645673.2; ENST00000423169.6; ENST00000267868.8; ENST00000382643.7; ENST00000557850.5; ENST00000532743.6; ENST00000525066.5
External Link	RMBase: m6A_site_271737
mod ID: M6ASITE022449		Click to Show/Hide the Full List
mod site	chr15:40731173-40731174:+		[7]
Sequence	TGGAGTGGGAGATGCCAAAGACTGAATCATTGGGTTTTTCC
Motif Score	3.319380952
Cell/Tissue List	A549; AML
Seq Type List	m6A-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000557850.5; ENST00000645673.2; ENST00000423169.6; ENST00000525066.5; ENST00000382643.7; ENST00000532743.6; ENST00000267868.8
External Link	RMBase: m6A_site_271738
mod ID: M6ASITE022450		Click to Show/Hide the Full List
mod site	chr15:40731204-40731205:+		[7]
Sequence	GGGTTTTTCCTCTGTTAAAAACCTTAAGTGCTGCAGCCTAA
Motif Score	2.185083333
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000557850.5; ENST00000525066.5; ENST00000267868.8; ENST00000382643.7; ENST00000645673.2; ENST00000532743.6; ENST00000423169.6
External Link	RMBase: m6A_site_271739
mod ID: M6ASITE022451		Click to Show/Hide the Full List
mod site	chr15:40731274-40731275:+		[8]
Sequence	ACAGGCCTCTTCCTGTTGTGACTGCCAGGATAAAGCTTCCG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000382643.7; ENST00000423169.6; ENST00000557850.5; ENST00000532743.6; ENST00000645673.2; ENST00000267868.8; ENST00000525066.5
External Link	RMBase: m6A_site_271740
mod ID: M6ASITE022452		Click to Show/Hide the Full List
mod site	chr15:40731340-40731341:+		[8]
Sequence	TCTGATGGTATAAACAGGAGACAGGTCAGTAGTCACAAACT
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000423169.6; ENST00000557850.5; ENST00000532743.6; ENST00000382643.7; ENST00000525066.5; ENST00000267868.8; ENST00000645673.2
External Link	RMBase: m6A_site_271741
mod ID: M6ASITE022453		Click to Show/Hide the Full List
mod site	chr15:40731354-40731355:+		[6]
Sequence	CAGGAGACAGGTCAGTAGTCACAAACTGATCTAAAATGTTT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000267868.8; ENST00000645673.2; ENST00000423169.6; ENST00000382643.7; ENST00000557850.5; ENST00000532743.6; ENST00000525066.5
External Link	RMBase: m6A_site_271742
mod ID: M6ASITE022454		Click to Show/Hide the Full List
mod site	chr15:40731445-40731446:+		[8]
Sequence	AGGGGTATGAAGTATCTTTGACATGGTGCCTTAGGAATGAC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000382643.7; ENST00000525066.5; ENST00000645673.2; ENST00000423169.6; ENST00000267868.8; ENST00000557850.5; ENST00000532743.6
External Link	RMBase: m6A_site_271743
mod ID: M6ASITE022455		Click to Show/Hide the Full List
mod site	chr15:40731475-40731476:+		[8]
Sequence	TTAGGAATGACTTGGGTTTAACAAGCTGTCTACTGGACAAT
Motif Score	2.168095238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000267868.8; ENST00000525066.5; ENST00000557850.5; ENST00000645673.2; ENST00000382643.7; ENST00000423169.6; ENST00000532743.6
External Link	RMBase: m6A_site_271744
mod ID: M6ASITE022456		Click to Show/Hide the Full List
mod site	chr15:40731513-40731514:+		[8]
Sequence	AATCTTATGTTTCCAAGAGAACTAAAGCTGGAGAGACCTGA
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000645673.2; ENST00000423169.6; ENST00000525066.5; ENST00000382643.7; ENST00000557850.5; ENST00000267868.8; ENST00000532743.6
External Link	RMBase: m6A_site_271745
mod ID: M6ASITE022457		Click to Show/Hide the Full List
mod site	chr15:40731533-40731534:+		[8]
Sequence	ACTAAAGCTGGAGAGACCTGACCCTTCTCTCACTTCTAAAT
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000557850.5; ENST00000382643.7; ENST00000532743.6; ENST00000645673.2; ENST00000423169.6; ENST00000525066.5; ENST00000267868.8
External Link	RMBase: m6A_site_271746

Ref 1	METTL3 promotes homologous recombination repair and modulates chemotherapeutic response in breast cancer by regulating the EGF/RAD51 axis. Elife. 2022 May 3;11:e75231. doi: 10.7554/eLife.75231.
Ref 2	Two concurrent phase II trials of paclitaxel/carboplatin/trastuzumab (weekly or every-3-week schedule) as first-line therapy in women with HER2-overexpressing metastatic breast cancer: NCCTG study 983252. Clin Breast Cancer. 2005 Dec;6(5):425-32. doi: 10.3816/CBC.2005.n.047.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map