General Information of the m6A Target Gene (ID: M6ATAR01484)
Target Name Polyunsaturated fatty acid lipoxygenase ALOX12 (ALOX12)
Synonyms
Arachidonate (12S)-lipoxygenase; Arachidonate (15S)-lipoxygenase; Linoleate (13S)-lipoxygenase; Lipoxin synthase 12-LO; Platelet-type lipoxygenase 12; 12S-LOX
    Click to Show/Hide
Gene Name ALOX12
Chromosomal Location 17p13.1
Family Lipoxygenase family
Function
Catalyzes the regio and stereo-specific incorporation of molecular oxygen into free and esterified polyunsaturated fatty acids generating lipid hydroperoxides that can be further reduced to the corresponding hydroxy species (PubMed:17493578, PubMed:1851637, PubMed:8319693, PubMed:8500694, PubMed:18311922, PubMed:32404334). Mainly converts arachidonate ((5Z,8Z,11Z,14Z)-eicosatetraenoate) to the specific bioactive lipid (12S)-hydroperoxyeicosatetraenoate/(12S)-HPETE (PubMed:17493578, PubMed:22984144, PubMed:24282679, PubMed:8319693, PubMed:8500694). Through the production of bioactive lipids like (12S)-HPETE it regulates different biological processes including platelet activation (PubMed:8319693, PubMed:8500694). It can also catalyze the epoxidation of double bonds of polyunsaturated fatty acids such as (14S)-hydroperoxy-docosahexaenoate/(14S)-HPDHA resulting in the formation of (13S,14S)-epoxy-DHA (PubMed:23504711). Furthermore, it may participate in the sequential oxidations of DHA ((4Z,7Z,10Z,13Z,16Z,19Z)-docosahexaenoate) to generate specialized pro-resolving mediators (SPMs) like resolvin D5 ((7S,17S)-diHPDHA) and (7S,14S)-diHPDHA, that actively down-regulate the immune response and have anti-aggregation properties with platelets (PubMed:32404334). An additional function involves a multistep process by which it transforms leukotriene A4/LTA4 into the bioactive lipids lipoxin A4/LXA4 and lipoxin B4/LXB4, both are vasoactive and LXA4 may regulate neutrophil function via occupancy of specific recognition sites (PubMed:8250832). Can also peroxidize linoleate ((9Z,12Z)-octadecadienoate) to (13S)-hydroperoxyoctadecadienoate/ (13S-HPODE) (By similarity). Due to its role in regulating both the expression of the vascular endothelial growth factor (VEGF, an angiogenic factor involved in the survival and metastasis of solid tumors) and the expression of integrin beta-1 (known to affect tumor cell migration and proliferation), it can be regarded as protumorigenic (PubMed:9751607, PubMed:16638750, PubMed:22237009). Important for cell survival, as it may play a role not only in proliferation but also in the prevention of apoptosis in vascular smooth muscle cells (PubMed:23578768).
    Click to Show/Hide
Gene ID 239
Uniprot ID
LOX12_HUMAN
HGNC ID
HGNC:429
KEGG ID
hsa:239
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01484)
Polyunsaturated fatty acid lipoxygenase ALOX12 (ALOX12)
N6-methyladenosine (m6A)
In total 6 m6A sequence/site(s) in this target gene
mod ID: M6ASITE029886 Click to Show/Hide the Full List
mod site chr17:6996856-6996857:+ [2]
Sequence TGATCATGACGTTGCAGAGGACTTGGGGCTCCTGCAGTTCG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; HEK293T; GM12878; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251535.11
External Link RMBase: m6A_site_345230
mod ID: M6ASITE029887 Click to Show/Hide the Full List
mod site chr17:6997000-6997001:+ [2]
Sequence CCGCTGGGTGCAGGGCGAGGACATCCTGAGCCTGCCCGAGG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; GM12878; Jurkat; CD4T; MSC; iSLK; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000251535.11; ENST00000480801.1
External Link RMBase: m6A_site_345231
mod ID: M6ASITE029888 Click to Show/Hide the Full List
mod site chr17:6998523-6998524:+ [2]
Sequence CCCAGCCCGCCTGCCAGGAGACAATGCTTTGGACATGTTCC
Motif Score 2.897386905
Cell/Tissue List HeLa; GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000480801.1; ENST00000251535.11
External Link RMBase: m6A_site_345232
mod ID: M6ASITE029889 Click to Show/Hide the Full List
mod site chr17:6998535-6998536:+ [2]
Sequence GCCAGGAGACAATGCTTTGGACATGTTCCAGAAGCATCGAG
Motif Score 3.643047619
Cell/Tissue List HeLa; GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000480801.1; ENST00000251535.11
External Link RMBase: m6A_site_345233
mod ID: M6ASITE029890 Click to Show/Hide the Full List
mod site chr17:7009682-7009683:+ [2]
Sequence TAAAATATGGGCATCCCAAAACAACAGCCTTTGTTCCTCTC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000406228.1; ENST00000251535.11
External Link RMBase: m6A_site_345238
mod ID: M6ASITE029892 Click to Show/Hide the Full List
mod site chr17:7009959-7009960:+ [2]
Sequence CAGTTTCTTCCTCCAGCTGGACTGGTATGCCTGGGTCCCTA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000406228.1; ENST00000251535.11
External Link RMBase: m6A_site_345240