General Information of the m6A Target Gene (ID: M6ATAR01480)
Target Name Macrophage colony-stimulating factor 1 receptor (CSF1R)
Synonyms
CSF-1 receptor; Proto-oncogene c-Fms; CSF-1-R
    Click to Show/Hide
Gene Name CSF1R
Chromosomal Location 5q32
Family Protein kinase superfamily, Tyr protein kinase family, CSF-1/PDGF receptor subfamily
Function
Tyrosine-protein kinase that acts as a cell-surface receptor for CSF1 and IL34 and plays an essential role in the regulation of survival, proliferation and differentiation of hematopoietic precursor cells, especially mononuclear phagocytes, such as macrophages and monocytes. Promotes the release of pro-inflammatory chemokines in response to IL34 and CSF1, and thereby plays an important role in innate immunity and in inflammatory processes. Plays an important role in the regulation of osteoclast proliferation and differentiation, the regulation of bone resorption, and is required for normal bone and tooth development. Required for normal male and female fertility, and for normal development of milk ducts and acinar structures in the mammary gland during pregnancy. Promotes reorganization of the actin cytoskeleton, regulates formation of membrane ruffles, cell adhesion and cell migration, and promotes cancer cell invasion. Activates several signaling pathways in response to ligand binding, including the ERK1/2 and the JNK pathway (PubMed:20504948, PubMed:30982609). Phosphorylates PIK3R1, PLCG2, GRB2, SLA2 and CBL. Activation of PLCG2 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate, that then lead to the activation of protein kinase C family members, especially PRKCD. Phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, leads to activation of the AKT1 signaling pathway. Activated CSF1R also mediates activation of the MAP kinases MAPK1/ERK2 and/or MAPK3/ERK1, and of the SRC family kinases SRC, FYN and YES1. Activated CSF1R transmits signals both via proteins that directly interact with phosphorylated tyrosine residues in its intracellular domain, or via adapter proteins, such as GRB2. Promotes activation of STAT family members STAT3, STAT5A and/or STAT5B. Promotes tyrosine phosphorylation of SHC1 and INPP5D/SHIP-1. Receptor signaling is down-regulated by protein phosphatases, such as INPP5D/SHIP-1, that dephosphorylate the receptor and its downstream effectors, and by rapid internalization of the activated receptor. In the central nervous system, may play a role in the development of microglia macrophages (PubMed:30982608).
    Click to Show/Hide
Gene ID 1436
Uniprot ID
CSF1R_HUMAN
HGNC ID
HGNC:2433
KEGG ID
hsa:1436
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 14 (METTL14)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03308
Epigenetic Regulator Lysine-specific demethylase 5B (KDM5B)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Non-small cell lung cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01480)
Macrophage colony-stimulating factor 1 receptor (CSF1R)
N6-methyladenosine (m6A)
In total 37 m6A sequence/site(s) in this target gene
mod ID: M6ASITE071925 Click to Show/Hide the Full List
mod site chr5:150053374-150053375:- [2]
Sequence ACACCAAGCAGGAAGCACAAACTCCCCCAAGCTGACTCATC
Motif Score 2.627720238
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693006
mod ID: M6ASITE071926 Click to Show/Hide the Full List
mod site chr5:150053414-150053415:- [2]
Sequence TCTGGGCTAGAAGGCAGGGGACCTTGGCATGTGGCTGGCCA
Motif Score 3.622404762
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693007
mod ID: M6ASITE071927 Click to Show/Hide the Full List
mod site chr5:150053562-150053563:- [3]
Sequence TCCTCTAAGAATCTCACAGGACCTCTTAGTCTCTGCCCTAT
Motif Score 3.622404762
Cell/Tissue List HeLa; CD4T; peripheral-blood; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693008
mod ID: M6ASITE071928 Click to Show/Hide the Full List
mod site chr5:150053618-150053619:- [3]
Sequence GGAGCAGCAGATGCTCACAGACCACACTCAGCTCAGGCCCC
Motif Score 2.876744048
Cell/Tissue List HeLa; CD4T; peripheral-blood; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693009
mod ID: M6ASITE071929 Click to Show/Hide the Full List
mod site chr5:150053674-150053675:- [3]
Sequence ACCAGGCTCTTTGGGGCTAGACAGACTGGCAGAGAGTGAGA
Motif Score 2.897386905
Cell/Tissue List HeLa; CD4T; peripheral-blood; MSC; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693010
mod ID: M6ASITE071930 Click to Show/Hide the Full List
mod site chr5:150053694-150053695:- [4]
Sequence GCTACACTGATACTGAGAAAACCAGGCTCTTTGGGGCTAGA
Motif Score 2.185083333
Cell/Tissue List HeLa; CD4T; peripheral-blood; MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693011
mod ID: M6ASITE071931 Click to Show/Hide the Full List
mod site chr5:150053744-150053745:- [5]
Sequence CCTTATCTTCATGGAAATGGACTGACTTTATGCCTATGAAG
Motif Score 4.065041667
Cell/Tissue List GM12878; CD8T; peripheral-blood; endometrial
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693012
mod ID: M6ASITE071932 Click to Show/Hide the Full List
mod site chr5:150053781-150053782:- [6]
Sequence TTGCTATGCCAACTAGTAGAACCTTCTTTCCTAATCCCCTT
Motif Score 2.930744048
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693013
mod ID: M6ASITE071933 Click to Show/Hide the Full List
mod site chr5:150053937-150053938:- [6]
Sequence CAGCTCGGCCCAGCTCTGAAACTTGGGAAGGTGAGGGATTC
Motif Score 2.627720238
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5; ENST00000509861.1
External Link RMBase: m6A_site_693014
mod ID: M6ASITE071934 Click to Show/Hide the Full List
mod site chr5:150053983-150053984:- [6]
Sequence GACACGGGGAGAACATACAAACTCTGCCTTCGGTCATTTCA
Motif Score 2.627720238
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000509861.1; ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693015
mod ID: M6ASITE071935 Click to Show/Hide the Full List
mod site chr5:150053991-150053992:- [6]
Sequence GATGGGGCGACACGGGGAGAACATACAAACTCTGCCTTCGG
Motif Score 2.951386905
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000509861.1; ENST00000504875.5
External Link RMBase: m6A_site_693016
mod ID: M6ASITE071936 Click to Show/Hide the Full List
mod site chr5:150054028-150054029:- [6]
Sequence ACCACTCTCCCCTCCCACAAACTTCAACTCCTCCATGGATG
Motif Score 2.627720238
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000509861.1; ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693017
mod ID: M6ASITE071937 Click to Show/Hide the Full List
mod site chr5:150060896-150060897:- [7]
Sequence CCACCTGGGCCAGCACGAGAACATCGTCAACCTTCTGGGAG
Motif Score 2.951386905
Cell/Tissue List CD4T; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000515068.1; ENST00000513609.1; ENST00000286301.7; ENST00000515239.5; ENST00000504875.5
External Link RMBase: m6A_site_693018
mod ID: M6ASITE071938 Click to Show/Hide the Full List
mod site chr5:150061589-150061590:- [6]
Sequence CTGTGTGCGTGGCAGGTAAGACCCTCGGAGCTGGAGCCTTT
Motif Score 2.876744048
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000513609.1; ENST00000286301.7; ENST00000504875.5; ENST00000515239.5; ENST00000515068.1
External Link RMBase: m6A_site_693019
mod ID: M6ASITE071939 Click to Show/Hide the Full List
mod site chr5:150061611-150061612:- [6]
Sequence GGTGCCCAGGGACTTAAGGGACCTGTGTGCGTGGCAGGTAA
Motif Score 3.622404762
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000513609.1; ENST00000286301.7; ENST00000515068.1; ENST00000515239.5; ENST00000504875.5
External Link RMBase: m6A_site_693020
mod ID: M6ASITE071940 Click to Show/Hide the Full List
mod site chr5:150061620-150061621:- [6]
Sequence AGGCCCTTTGGTGCCCAGGGACTTAAGGGACCTGTGTGCGT
Motif Score 4.065041667
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000504875.5; ENST00000515068.1; ENST00000286301.7; ENST00000515239.5; ENST00000513609.1
External Link RMBase: m6A_site_693021
mod ID: M6ASITE071941 Click to Show/Hide the Full List
mod site chr5:150067037-150067038:- [6]
Sequence GGGAGTTCAGAGGTGGACGGACTTTTCAGGCTGGTGGGTAA
Motif Score 4.065041667
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000513609.1; ENST00000504875.5; ENST00000515239.5
External Link RMBase: m6A_site_693022
mod ID: M6ASITE071942 Click to Show/Hide the Full List
mod site chr5:150067075-150067076:- [6]
Sequence TGTGATCAGAAGCTGAGAGGACCAGGCCAGAGGGCTGTGGG
Motif Score 3.622404762
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000504875.5; ENST00000513609.1; ENST00000515239.5; ENST00000286301.7
External Link RMBase: m6A_site_693023
mod ID: M6ASITE071943 Click to Show/Hide the Full List
mod site chr5:150067106-150067107:- [6]
Sequence GCCTGCCTGCCCACACAAAGACCATGTGCAATGTGATCAGA
Motif Score 2.876744048
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000513609.1; ENST00000515239.5; ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693024
mod ID: M6ASITE071944 Click to Show/Hide the Full List
mod site chr5:150069938-150069939:- [2]
Sequence AGACCTTAGAGCACAACCAAACCTACGAGTGCAGGGCCCAC
Motif Score 2.185083333
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693025
mod ID: M6ASITE071945 Click to Show/Hide the Full List
mod site chr5:150069956-150069957:- [2]
Sequence AGAGCCTGCTGACTGTTGAGACCTTAGAGCACAACCAAACC
Motif Score 2.876744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693026
mod ID: M6ASITE071946 Click to Show/Hide the Full List
mod site chr5:150070275-150070276:- [8]
Sequence CAGAGGTAAGCGTCATATGGACATTCATCAACGGCTCTGGC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693027
mod ID: M6ASITE071947 Click to Show/Hide the Full List
mod site chr5:150070499-150070500:- [8]
Sequence CTACTCCTTCCTGGCCAGAAACCCAGGAGGCTGGAGAGCTC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693028
mod ID: M6ASITE071948 Click to Show/Hide the Full List
mod site chr5:150073309-150073310:- [8]
Sequence TGCTAATGCTACCACCAAGGACACATACAGGTACCACTTAT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000543093.1; ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693029
mod ID: M6ASITE071949 Click to Show/Hide the Full List
mod site chr5:150073362-150073363:- [8]
Sequence TTTAACTGGACCTACCTGGGACCCTTTTCTGACCACCAGCC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000543093.1; ENST00000504875.5; ENST00000286301.7
External Link RMBase: m6A_site_693030
mod ID: M6ASITE071950 Click to Show/Hide the Full List
mod site chr5:150073373-150073374:- [8]
Sequence GCCTGCAAGGTTTTAACTGGACCTACCTGGGACCCTTTTCT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000543093.1; ENST00000504875.5
External Link RMBase: m6A_site_693031
mod ID: M6ASITE071951 Click to Show/Hide the Full List
mod site chr5:150080122-150080123:- [8]
Sequence CAAGTTCATTCAGAGCCAGGACTATCAATGCAGTGCCCTGA
Motif Score 4.065041667
Cell/Tissue List HeLa; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000511344.1; ENST00000543093.1; ENST00000286301.7; ENST00000502660.5; ENST00000504875.5
External Link RMBase: m6A_site_693032
mod ID: M6ASITE071952 Click to Show/Hide the Full List
mod site chr5:150080251-150080252:- [8]
Sequence ACTGCCCTGTCTGCTCACAGACCCGGTGCTGGAAGCAGGCG
Motif Score 2.876744048
Cell/Tissue List HeLa; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000504875.5; ENST00000502660.5; ENST00000286301.7; ENST00000511344.1; ENST00000543093.1
External Link RMBase: m6A_site_693033
mod ID: M6ASITE071953 Click to Show/Hide the Full List
mod site chr5:150080284-150080285:- [6]
Sequence GGAGGTGGTCGTGTTCGAGGACCAGGACGCACTACTGCCCT
Motif Score 3.622404762
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000502660.5; ENST00000286301.7; ENST00000511344.1; ENST00000543093.1; ENST00000504875.5
External Link RMBase: m6A_site_693034
mod ID: M6ASITE071954 Click to Show/Hide the Full List
mod site chr5:150080807-150080808:- [6]
Sequence TCGCTGCACTGAGCCTGGAGACCCCCTGGGAGGCAGCGCCG
Motif Score 2.876744048
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000511344.1; ENST00000286301.7; ENST00000502660.5; ENST00000504875.5; ENST00000543093.1
External Link RMBase: m6A_site_693035
mod ID: M6ASITE071955 Click to Show/Hide the Full List
mod site chr5:150080832-150080833:- [6]
Sequence CTACCTTCCAAAACACGGGGACCTATCGCTGCACTGAGCCT
Motif Score 3.622404762
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000504875.5; ENST00000543093.1; ENST00000502660.5; ENST00000286301.7; ENST00000511344.1
External Link RMBase: m6A_site_693036
mod ID: M6ASITE071956 Click to Show/Hide the Full List
mod site chr5:150080840-150080841:- [6]
Sequence CAACAACGCTACCTTCCAAAACACGGGGACCTATCGCTGCA
Motif Score 2.20572619
Cell/Tissue List peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000543093.1; ENST00000286301.7; ENST00000502660.5; ENST00000511344.1; ENST00000504875.5
External Link RMBase: m6A_site_693037
mod ID: M6ASITE071957 Click to Show/Hide the Full List
mod site chr5:150080898-150080899:- [8]
Sequence GCCCCCCATCACCTCACTGGACCCTGTACTCTGATGGCTCC
Motif Score 3.622404762
Cell/Tissue List HeLa; peripheral-blood; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000502660.5; ENST00000504875.5; ENST00000543093.1; ENST00000511344.1
External Link RMBase: m6A_site_693038
mod ID: M6ASITE071958 Click to Show/Hide the Full List
mod site chr5:150086555-150086556:- [8]
Sequence AGGAGGAAGAGGAAAACAAGACAAACAGCCAGTGCAGAGGA
Motif Score 2.897386905
Cell/Tissue List HeLa; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000511344.1; ENST00000286301.7; ENST00000504875.5
External Link RMBase: m6A_site_693039
mod ID: M6ASITE071959 Click to Show/Hide the Full List
mod site chr5:150086560-150086561:- [8]
Sequence CAAGGAGGAGGAAGAGGAAAACAAGACAAACAGCCAGTGCA
Motif Score 2.20572619
Cell/Tissue List HeLa; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000286301.7; ENST00000504875.5; ENST00000511344.1
External Link RMBase: m6A_site_693040
mod ID: M6ASITE071960 Click to Show/Hide the Full List
mod site chr5:150113271-150113272:- [8]
Sequence GAAGAGAGGAAGCGGAGGGAACTGCGGCCAGGGTAAGGACA
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286301.7; ENST00000511344.1
External Link RMBase: m6A_site_693044
mod ID: M6ASITE071961 Click to Show/Hide the Full List
mod site chr5:150113362-150113363:- [8]
Sequence CCCAGGTAGGAGAAGGGCAGACAGAGTGTCCAAAAGCGTGA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286301.7; ENST00000511344.1
External Link RMBase: m6A_site_693045