m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01469)

Target Name	NPC1-like intracellular cholesterol transporter 1 (NPC1L1)
Synonyms	NPC1L1; Niemann-Pick C1-like protein 1 Click to Show/Hide
Gene Name	NPC1L1
Chromosomal Location	7p13
Family	Patched family
Function	Plays a major role in cholesterol homeostasis (PubMed:22095670). Critical for the uptake of cholesterol across the plasma membrane of the intestinal enterocyte (PubMed:22095670). Involved in plant sterol absorption, it transports sitosterol, although at lower rates than cholesterol (By similarity). Is the direct molecular target of ezetimibe, a drug that inhibits cholesterol absorption and is approved for the treatment of hypercholesterolemia (PubMed:15928087). May have a function in the transport of multiple lipids and their homeostasis, thereby influencing lipid metabolism regulation (PubMed:15671032). May be involved in caveolin trafficking from the plasma membrane (By similarity). In addition, acts as a negative regulator of NPC2 and down-regulates its expression and secretion by inhibiting its maturation and accelerating its degradation (PubMed:22095670). Click to Show/Hide
Gene ID	29881
Uniprot ID	NPCL1_HUMAN
HGNC ID	HGNC:7898
KEGG ID	hsa:29881

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01469)

NPC1-like intracellular cholesterol transporter 1 (NPC1L1)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004103		Click to Show/Hide the Full List
mod site	chr7:44532171-44532172:-		[2]
Sequence	GTGTCAAGCCCCAGGAGCTGCCCCCGCCTGGCCAGGGAGAG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000289547.8; ENST00000546276.5; ENST00000381160.7
External Link	RMBase: m5C_site_39256

N6-methyladenosine (m6A)

In total 19 m6A sequence/site(s) in this target gene
mod ID: M6ASITE079878		Click to Show/Hide the Full List
mod site	chr7:44512550-44512551:-		[3]
Sequence	TGCACATAGGTGTTTAATAAACATTTGTTGGCAGAAATGGT
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000289547.8; ENST00000546276.5
External Link	RMBase: m6A_site_756168
mod ID: M6ASITE079879		Click to Show/Hide the Full List
mod site	chr7:44516165-44516166:-		[4]
Sequence	GTCTGTGGAGTTTGTGTCCCACATTACCCGCTCCTTTGCCA
Motif Score	2.053113095
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000546276.5; ENST00000289547.8; ENST00000381160.7
External Link	RMBase: m6A_site_756169
mod ID: M6ASITE079880		Click to Show/Hide the Full List
mod site	chr7:44538837-44538838:-		[3]
Sequence	CTCCCAAGTCGACTGGAAGGACCATTTTCTGTACTGTGCCA
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000423141.1; ENST00000546276.5; ENST00000381160.7; ENST00000289547.8
External Link	RMBase: m6A_site_756170
mod ID: M6ASITE079881		Click to Show/Hide the Full List
mod site	chr7:44538859-44538860:-		[3]
Sequence	ACCAGACACTGATGGGGCAGACCTCCCAAGTCGACTGGAAG
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000546276.5; ENST00000423141.1; ENST00000381160.7; ENST00000289547.8
External Link	RMBase: m6A_site_756171
mod ID: M6ASITE079882		Click to Show/Hide the Full List
mod site	chr7:44538874-44538875:-		[3]
Sequence	TGCTGCTCACAGCCAACCAGACACTGATGGGGCAGACCTCC
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000423141.1; ENST00000546276.5; ENST00000381160.7; ENST00000289547.8
External Link	RMBase: m6A_site_756172
mod ID: M6ASITE079883		Click to Show/Hide the Full List
mod site	chr7:44538909-44538910:-		[5]
Sequence	CCTCCTGCAGTATTTCCAGAACAACCGCACGCTCCTGCTGC
Motif Score	2.951386905
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000289547.8; ENST00000423141.1; ENST00000381160.7; ENST00000546276.5
External Link	RMBase: m6A_site_756173
mod ID: M6ASITE079884		Click to Show/Hide the Full List
mod site	chr7:44538963-44538964:-		[5]
Sequence	CTACGCCCCCCTCAATCCGGACAATACCAGTCTCTACGACT
Motif Score	3.643047619
Cell/Tissue List	HepG2; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000381160.7; ENST00000546276.5; ENST00000289547.8; ENST00000423141.1
External Link	RMBase: m6A_site_756174
mod ID: M6ASITE079885		Click to Show/Hide the Full List
mod site	chr7:44538990-44538991:-		[5]
Sequence	GCGCAACATCTCCCTGCAGGACATCTGCTACGCCCCCCTCA
Motif Score	3.643047619
Cell/Tissue List	HepG2; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546276.5; ENST00000423141.1; ENST00000381160.7; ENST00000289547.8
External Link	RMBase: m6A_site_756175
mod ID: M6ASITE079886		Click to Show/Hide the Full List
mod site	chr7:44539080-44539081:-		[6]
Sequence	CAGCGGAATCCTGGACCTGGACTTGCTGCTGGAGCTGCTAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000381160.7; ENST00000289547.8; ENST00000423141.1; ENST00000546276.5
External Link	RMBase: m6A_site_756176
mod ID: M6ASITE079887		Click to Show/Hide the Full List
mod site	chr7:44539086-44539087:-		[6]
Sequence	GAACTTCAGCGGAATCCTGGACCTGGACTTGCTGCTGGAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000423141.1; ENST00000546276.5; ENST00000381160.7; ENST00000289547.8
External Link	RMBase: m6A_site_756177
mod ID: M6ASITE079888		Click to Show/Hide the Full List
mod site	chr7:44539104-44539105:-		[6]
Sequence	TCTGCTGCTGGGGCCCAAGAACTTCAGCGGAATCCTGGACC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000423141.1; ENST00000289547.8; ENST00000546276.5; ENST00000381160.7
External Link	RMBase: m6A_site_756178
mod ID: M6ASITE079889		Click to Show/Hide the Full List
mod site	chr7:44539177-44539178:-		[6]
Sequence	ATTTCGGCCCCTTCTTCCGAACCAACCAGGTGATCCTGACG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000423141.1; ENST00000546276.5; ENST00000289547.8; ENST00000381160.7
External Link	RMBase: m6A_site_756179
mod ID: M6ASITE079890		Click to Show/Hide the Full List
mod site	chr7:44539443-44539444:-		[7]
Sequence	GGACAAAAGCAAGATGGTGGACCCCAAGAAGGGCACCAGCC
Motif Score	3.622404762
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000289547.8; ENST00000546276.5; ENST00000423141.1; ENST00000381160.7
External Link	RMBase: m6A_site_756180
mod ID: M6ASITE079891		Click to Show/Hide the Full List
mod site	chr7:44539461-44539462:-		[7]
Sequence	CCGTGTGGCCCCCGCCAGGGACAAAAGCAAGATGGTGGACC
Motif Score	3.643047619
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000546276.5; ENST00000381160.7; ENST00000423141.1; ENST00000289547.8
External Link	RMBase: m6A_site_756181
mod ID: M6ASITE079892		Click to Show/Hide the Full List
mod site	chr7:44539623-44539624:-		[8]
Sequence	GGCGACCTGCTCCTGCCAAGACTGTGCTGCATCCTGTCCTG
Motif Score	3.319380952
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000289547.8; ENST00000546276.5; ENST00000381160.7; ENST00000423141.1
External Link	RMBase: m6A_site_756182
mod ID: M6ASITE079893		Click to Show/Hide the Full List
mod site	chr7:44539746-44539747:-		[6]
Sequence	CAATGGTCTGGCCCCACTGGACATCACCTTCCACCTCTTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000423141.1; ENST00000381160.7; ENST00000546276.5; ENST00000289547.8
External Link	RMBase: m6A_site_756183
mod ID: M6ASITE079894		Click to Show/Hide the Full List
mod site	chr7:44539773-44539774:-		[6]
Sequence	CTGGCTCAACTTCCAGGGAGACACAGGCAATGGTCTGGCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000546276.5; ENST00000381160.7; ENST00000289547.8; ENST00000423141.1
External Link	RMBase: m6A_site_756184
mod ID: M6ASITE079895		Click to Show/Hide the Full List
mod site	chr7:44539952-44539953:-		[3]
Sequence	GTGGCCCAGCTAGGGGCTGGACAACTCCCAGCTGTGGTGGC
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000423141.1; ENST00000546276.5; ENST00000289547.8; ENST00000381160.7
External Link	RMBase: m6A_site_756185
mod ID: M6ASITE079896		Click to Show/Hide the Full List
mod site	chr7:44540031-44540032:-		[3]
Sequence	CTGCTCTGACAATTTTGTGAACCTGCACTGCCACAACACGT
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000423141.1; ENST00000289547.8; ENST00000546276.5; ENST00000381160.7
External Link	RMBase: m6A_site_756186

Ref 1	US patent application no. 6,159,734, Antisense modulation of peroxisome proliferator-activated receptor gamma expression.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 4	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 5	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 8	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map