m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01439)

Target Name	Cytochrome P450 2B6 (CYP2B6)
Synonyms	EC 1.14.13.-; 1,4-cineole 2-exo-monooxygenase; CYPIIB6; Cytochrome P450 IIB1 Click to Show/Hide
Gene Name	CYP2B6
Chromosomal Location	19q13.2
Family	Cytochrome P450 family
Function	A cytochrome P450 monooxygenase involved in the metabolism of endocannabinoids and steroids (PubMed:21289075, PubMed:12865317). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase). Catalyzes the epoxidation of double bonds of arachidonoylethanolamide (anandamide) to 8,9-, 11,12-, and 14,15-epoxyeicosatrienoic acid ethanolamides (EpETrE-EAs), potentially modulating endocannabinoid system signaling (PubMed:21289075). Hydroxylates steroid hormones, including testosterone at C-16 and estrogens at C-2 (PubMed:21289075, PubMed:12865317). Plays a role in the oxidative metabolism of xenobiotics, including plant lipids and drugs (PubMed:11695850, PubMed:22909231). Acts as a 1,4-cineole 2-exo-monooxygenase (PubMed:11695850). Click to Show/Hide
Gene ID	1555
Uniprot ID	CP2B6_HUMAN
HGNC ID	HGNC:2615
KEGG ID	hsa:1555

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01439)

Cytochrome P450 2B6 (CYP2B6)

N6-methyladenosine (m6A)

In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE041259		Click to Show/Hide the Full List
mod site	chr19:40991341-40991342:+		[2]
Sequence	TCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTACTCCTG
Motif Score	2.047297619
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000324071.10
External Link	RMBase: m6A_site_439997
mod ID: M6ASITE041260		Click to Show/Hide the Full List
mod site	chr19:41009335-41009336:+		[3]
Sequence	GTGTGGAGAAGCACCGTGAAACCCTGGACCCCAGCGCCCCC
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000324071.10; ENST00000593831.1; ENST00000598834.2
External Link	RMBase: m6A_site_439998
mod ID: M6ASITE041261		Click to Show/Hide the Full List
mod site	chr19:41009342-41009343:+		[3]
Sequence	GAAGCACCGTGAAACCCTGGACCCCAGCGCCCCCAAGGACC
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000593831.1; ENST00000598834.2; ENST00000324071.10
External Link	RMBase: m6A_site_439999
mod ID: M6ASITE041262		Click to Show/Hide the Full List
mod site	chr19:41009360-41009361:+		[3]
Sequence	GGACCCCAGCGCCCCCAAGGACCTCATCGACACCTACCTGC
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000593831.1; ENST00000598834.2; ENST00000324071.10
External Link	RMBase: m6A_site_440000
mod ID: M6ASITE041263		Click to Show/Hide the Full List
mod site	chr19:41009692-41009693:+		[3]
Sequence	GAAGGAATTCGGGGCAAGGGACAAAAATACAGCAACAAGAG
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000597612.1; ENST00000324071.10; ENST00000593831.1
External Link	RMBase: m6A_site_440001
mod ID: M6ASITE041264		Click to Show/Hide the Full List
mod site	chr19:41009718-41009719:+		[3]
Sequence	ATACAGCAACAAGAGAAAAAACTCACAGAGGCAGAAAGAGA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000593831.1; ENST00000324071.10; ENST00000597612.1
External Link	RMBase: m6A_site_440002
mod ID: M6ASITE041265		Click to Show/Hide the Full List
mod site	chr19:41009744-41009745:+		[3]
Sequence	AGAGGCAGAAAGAGACGGGGACAAAAAGAGAGAAACACATC
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000597612.1; ENST00000593831.1; ENST00000324071.10
External Link	RMBase: m6A_site_440003
mod ID: M6ASITE041266		Click to Show/Hide the Full List
mod site	chr19:41009758-41009759:+		[3]
Sequence	ACGGGGACAAAAAGAGAGAAACACATCAAAGAGATGTGGAG
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000593831.1; ENST00000324071.10; ENST00000598834.2; ENST00000597612.1
External Link	RMBase: m6A_site_440004
mod ID: M6ASITE041267		Click to Show/Hide the Full List
mod site	chr19:41009789-41009790:+		[3]
Sequence	AGATGTGGAGAGAGATAGAAACAGAGTTAGGAAGACTAAAG
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000597612.1; ENST00000593831.1; ENST00000598834.2; ENST00000324071.10
External Link	RMBase: m6A_site_440005
mod ID: M6ASITE041268		Click to Show/Hide the Full List
mod site	chr19:41009803-41009804:+		[3]
Sequence	ATAGAAACAGAGTTAGGAAGACTAAAGAGAGGCTGAGAGAG
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000593831.1; ENST00000324071.10; ENST00000597612.1
External Link	RMBase: m6A_site_440006
mod ID: M6ASITE041269		Click to Show/Hide the Full List
mod site	chr19:41009858-41009859:+		[3]
Sequence	CGCGGTTGGATGTGTAGAGGACAGAGAAAAGCAAACTGGGC
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000593831.1; ENST00000324071.10; ENST00000598834.2; ENST00000597612.1
External Link	RMBase: m6A_site_440007
mod ID: M6ASITE041270		Click to Show/Hide the Full List
mod site	chr19:41009872-41009873:+		[3]
Sequence	TAGAGGACAGAGAAAAGCAAACTGGGCCAGATAGTGTCAAA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000597612.1; ENST00000593831.1; ENST00000324071.10
External Link	RMBase: m6A_site_440008
mod ID: M6ASITE041271		Click to Show/Hide the Full List
mod site	chr19:41009894-41009895:+		[3]
Sequence	TGGGCCAGATAGTGTCAAAGACCTTTAGGCCAACGGAGGGC
Motif Score	2.876744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000324071.10; ENST00000597612.1; ENST00000593831.1
External Link	RMBase: m6A_site_440009
mod ID: M6ASITE041272		Click to Show/Hide the Full List
mod site	chr19:41012306-41012307:+		[2]
Sequence	TTTCTGTACAGAGAGAGTCTACAGGGAGATTGAACAGGTGA
Motif Score	2.078666667
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000598834.2; ENST00000324071.10; ENST00000593831.1; ENST00000597612.1
External Link	RMBase: m6A_site_440010
mod ID: M6ASITE041273		Click to Show/Hide the Full List
mod site	chr19:41012319-41012320:+		[3]
Sequence	AGAGTCTACAGGGAGATTGAACAGGTGATTGGCCCACATCG
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000324071.10; ENST00000593831.1; ENST00000597612.1; ENST00000598834.2
External Link	RMBase: m6A_site_440011
mod ID: M6ASITE041274		Click to Show/Hide the Full List
mod site	chr19:41012732-41012733:+		[3]
Sequence	GACCCACACTACTTTGAAAAACCAGACGCCTTCAATCCTGA
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000593831.1; ENST00000598834.2; ENST00000324071.10; ENST00000597612.1
External Link	RMBase: m6A_site_440012
mod ID: M6ASITE041275		Click to Show/Hide the Full List
mod site	chr19:41012787-41012788:+		[3]
Sequence	CCAATGGGGCACTGAAAAAGACTGAAGCTTTTATCCCCTTC
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000593831.1; ENST00000324071.10; ENST00000597612.1
External Link	RMBase: m6A_site_440013
mod ID: M6ASITE041276		Click to Show/Hide the Full List
mod site	chr19:41013023-41013024:+		[3]
Sequence	GGCACATCTTGGCAAGCAGGACCTTGGGCAAGTATTTTAAC
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000324071.10; ENST00000593831.1; ENST00000597612.1; ENST00000598834.2; rmsk_5000070
External Link	RMBase: m6A_site_440014
mod ID: M6ASITE041277		Click to Show/Hide the Full List
mod site	chr19:41016717-41016718:+		[3]
Sequence	CTTCACCACCATCCTCCAGAACTTCTCCATGGCCAGCCCCG
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000598834.2; ENST00000593831.1; ENST00000597612.1; ENST00000324071.10
External Link	RMBase: m6A_site_440015
mod ID: M6ASITE041278		Click to Show/Hide the Full List
mod site	chr19:41016750-41016751:+		[3]
Sequence	CAGCCCCGTGGCCCCAGAAGACATCGATCTGACACCCCAGG
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000593831.1; ENST00000597612.1; ENST00000324071.10; ENST00000598834.2
External Link	RMBase: m6A_site_440016
mod ID: M6ASITE041279		Click to Show/Hide the Full List
mod site	chr19:41016887-41016888:+		[4]
Sequence	CAGTGTCCCCGCCTCTGTAGACAATGGCTCTGACTCCCCGC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000597612.1; ENST00000324071.10; ENST00000593831.1; ENST00000598834.2
External Link	RMBase: m6A_site_440017
mod ID: M6ASITE041280		Click to Show/Hide the Full List
mod site	chr19:41016927-41016928:+		[4]
Sequence	CAACTTCCTGCCTCTGAGAGACCTGCTACAAGCCAGCTTCC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000598834.2; ENST00000593831.1; ENST00000597612.1; ENST00000324071.10
External Link	RMBase: m6A_site_440018
mod ID: M6ASITE041281		Click to Show/Hide the Full List
mod site	chr19:41016979-41016980:+		[2]
Sequence	GGCACCAGTTGTCTGAGGTCACATTGCAAGTGAGTGCAGGA
Motif Score	2.047297619
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000324071.10; ENST00000598834.2; ENST00000593831.1; ENST00000597612.1
External Link	RMBase: m6A_site_440019
mod ID: M6ASITE041282		Click to Show/Hide the Full List
mod site	chr19:41017661-41017662:+		[3]
Sequence	GTATTTTTAGGTGGTCTTGAACTCCTGATGTCAGGTGATTC
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000324071.10; ENST00000597612.1
External Link	RMBase: m6A_site_440020
mod ID: M6ASITE041283		Click to Show/Hide the Full List
mod site	chr19:41017722-41017723:+		[3]
Sequence	ATTATCTCTCCCCCAACAAAACCCATACCTATCAAGCTGTC
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000597612.1; ENST00000324071.10
External Link	RMBase: m6A_site_440021
mod ID: M6ASITE041284		Click to Show/Hide the Full List
mod site	chr19:41017806-41017807:+		[3]
Sequence	TCTGGTTTTTGTCACTATGGACTTACCAATTCTGAATATTT
Motif Score	4.065041667
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000597612.1; ENST00000324071.10
External Link	RMBase: m6A_site_440022
mod ID: M6ASITE041285		Click to Show/Hide the Full List
mod site	chr19:41017834-41017835:+		[3]
Sequence	ATTCTGAATATTTCCCATAAACAGAATCATACAATATTTGA
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000324071.10; ENST00000597612.1
External Link	RMBase: m6A_site_440023
mod ID: M6ASITE041286		Click to Show/Hide the Full List
mod site	chr19:41017874-41017875:+		[3]
Sequence	ATTTTTTTTTTTTTTTTGAAACTAAGCCTTGCTCTGTCTCC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000324071.10
External Link	RMBase: m6A_site_440024

Ref 1	Inhibition of endothelial cell adhesion molecule expression improves colonic hyperalgaesia. Neurogastroenterol Motil. 2009 Feb;21(2):189-96. doi: 10.1111/j.1365-2982.2008.01222.x. Epub 2008 Dec 5.
Ref 2	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 3	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map