m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01429)

Target Name	Superoxide dismutase 1 (SOD1)
Synonyms	Superoxide dismutase 1; hSod1 Click to Show/Hide
Gene Name	SOD1
Chromosomal Location	21q22.11
Family	Cu-Zn superoxide dismutase family
Function	Destroys radicals which are normally produced within the cells and which are toxic to biological systems. Click to Show/Hide
Gene ID	6647
Uniprot ID	SODC_HUMAN
HGNC ID	HGNC:11179
KEGG ID	hsa:6647

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01429)

Superoxide dismutase 1 (SOD1)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010873		Click to Show/Hide the Full List
mod site	chr21:31660904-31660905:+		[2]
Sequence	ATTTTCGTAAAGTGGCTTTAAAATTGCTCTGCCAGTAGGCA
Transcript ID List	ENST00000470944.1; ENST00000476106.5; ENST00000270142.10; ENST00000389995.4
External Link	RMBase: RNA-editing_site_89151
mod ID: A2ISITE010874		Click to Show/Hide the Full List
mod site	chr21:31662732-31662733:+		[2]
Sequence	TAATTAAAAATACCTGTGATAGCCGGGCGTGGTGGCTTACG
Transcript ID List	ENST00000389995.4; ENST00000476106.5; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: RNA-editing_site_89152

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002813		Click to Show/Hide the Full List
mod site	chr21:31661507-31661508:+
Sequence	CGGGTAGCTGGGACTACAGGCGCGCGCCGCCACGCCTGGCT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000476106.5; ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m5C_site_29879
mod ID: M5CSITE002814		Click to Show/Hide the Full List
mod site	chr21:31668467-31668468:+		[3]
Sequence	TATCTTCTTAAAATTTTTTACAGGTCCATGAAAAAGCAGAT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000470944.1; ENST00000270142.10; ENST00000389995.4
External Link	RMBase: m5C_site_29880

N6-methyladenosine (m6A)

In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE055069		Click to Show/Hide the Full List
mod site	chr21:31659740-31659741:+		[4]
Sequence	TTTCCGTTGCAGTCCTCGGAACCAGGACCTCGGCGTGGCCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; MT4; A549; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000270142.10; ENST00000389995.4; ENST00000476106.5; ENST00000470944.1
External Link	RMBase: m6A_site_544815
mod ID: M6ASITE055070		Click to Show/Hide the Full List
mod site	chr21:31659746-31659747:+		[4]
Sequence	TTGCAGTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; MT4; A549; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000389995.4; ENST00000470944.1; ENST00000476106.5; ENST00000270142.10
External Link	RMBase: m6A_site_544816
mod ID: M6ASITE055071		Click to Show/Hide the Full List
mod site	chr21:31663830-31663831:+		[5]
Sequence	GTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGG
Motif Score	4.065041667
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000389995.4; ENST00000476106.5; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: m6A_site_544817
mod ID: M6ASITE055072		Click to Show/Hide the Full List
mod site	chr21:31666491-31666492:+		[6]
Sequence	TTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; HepG2
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000476106.5; ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m6A_site_544818
mod ID: M6ASITE055074		Click to Show/Hide the Full List
mod site	chr21:31667268-31667269:+		[5]
Sequence	CATTATTAGGCATGTTGGAGACTTGGGCAATGTGACTGCTG
Motif Score	3.319380952
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000270142.10; ENST00000470944.1; ENST00000389995.4; ENST00000476106.5
External Link	RMBase: m6A_site_544825
mod ID: M6ASITE055075		Click to Show/Hide the Full List
mod site	chr21:31667289-31667290:+		[6]
Sequence	CTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000470944.1; ENST00000389995.4; ENST00000476106.5; ENST00000270142.10
External Link	RMBase: m6A_site_544826
mod ID: M6ASITE055076		Click to Show/Hide the Full List
mod site	chr21:31667346-31667347:+		[5]
Sequence	TGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCA
Motif Score	2.876744048
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000389995.4; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: m6A_site_544827
mod ID: M6ASITE055077		Click to Show/Hide the Full List
mod site	chr21:31667366-31667367:+		[6]
Sequence	ACCATTGCATCATTGGCCGCACACTGGTGGTAAGTTTTCAT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000270142.10; ENST00000470944.1; ENST00000389995.4
External Link	RMBase: m6A_site_544828
mod ID: M6ASITE055079		Click to Show/Hide the Full List
mod site	chr21:31668518-31668519:+		[6]
Sequence	AAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000470944.1; ENST00000270142.10; ENST00000389995.4
External Link	RMBase: m6A_site_544830
mod ID: M6ASITE055080		Click to Show/Hide the Full List
mod site	chr21:31668524-31668525:+		[5]
Sequence	GAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGT
Motif Score	2.897386905
Cell/Tissue List	HepG2; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000470944.1; ENST00000270142.10; ENST00000389995.4
External Link	RMBase: m6A_site_544831
mod ID: M6ASITE055081		Click to Show/Hide the Full List
mod site	chr21:31668578-31668579:+		[4]
Sequence	TAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAGTCT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m6A_site_544832
mod ID: M6ASITE055082		Click to Show/Hide the Full List
mod site	chr21:31668610-31668611:+		[7]
Sequence	ATGTAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m6A_site_544833
mod ID: M6ASITE055083		Click to Show/Hide the Full List
mod site	chr21:31668653-31668654:+		[4]
Sequence	GTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m6A_site_544834
mod ID: M6ASITE055084		Click to Show/Hide the Full List
mod site	chr21:31668660-31668661:+		[4]
Sequence	TGTATCCTGATAAACATTAAACACTGTAATCTTAAAAGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000389995.4; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: m6A_site_544835
mod ID: M6ASITE055085		Click to Show/Hide the Full List
mod site	chr21:31668662-31668663:+		[7]
Sequence	TATCCTGATAAACATTAAACACTGTAATCTTAAAAGTGTAA
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000470944.1; ENST00000270142.10; ENST00000389995.4
External Link	RMBase: m6A_site_544836
mod ID: M6ASITE055086		Click to Show/Hide the Full List
mod site	chr21:31668690-31668691:+		[7]
Sequence	CTTAAAAGTGTAATTGTGTGACTTTTTCAGAGTTGCTTTAA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000389995.4; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: m6A_site_544837
mod ID: M6ASITE055087		Click to Show/Hide the Full List
mod site	chr21:31668714-31668715:+		[7]
Sequence	TTTCAGAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATT
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000270142.10; ENST00000470944.1; ENST00000389995.4
External Link	RMBase: m6A_site_544838
mod ID: M6ASITE055088		Click to Show/Hide the Full List
mod site	chr21:31668728-31668729:+		[4]
Sequence	TAAAGTACCTGTAGTGAGAAACTGATTTATGATCACTTGGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000389995.4; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: m6A_site_544839
mod ID: M6ASITE055090		Click to Show/Hide the Full List
mod site	chr21:31668742-31668743:+		[7]
Sequence	TGAGAAACTGATTTATGATCACTTGGAAGATTTGTATAGTT
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m6A_site_544840
mod ID: M6ASITE055091		Click to Show/Hide the Full List
mod site	chr21:31668770-31668771:+		[4]
Sequence	GATTTGTATAGTTTTATAAAACTCAGTTAAAATGTCTGTTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000470944.1; ENST00000389995.4; ENST00000270142.10
External Link	RMBase: m6A_site_544841
mod ID: M6ASITE055092		Click to Show/Hide the Full List
mod site	chr21:31668796-31668797:+		[7]
Sequence	TTAAAATGTCTGTTTCAATGACCTGTATTTTGCCAGACTTA
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000389995.4; ENST00000270142.10; ENST00000470944.1
External Link	RMBase: m6A_site_544842
mod ID: M6ASITE055093		Click to Show/Hide the Full List
mod site	chr21:31668812-31668813:+		[4]
Sequence	AATGACCTGTATTTTGCCAGACTTAAATCACAGATGGGTAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000270142.10; ENST00000389995.4; ENST00000470944.1
External Link	RMBase: m6A_site_544843
mod ID: M6ASITE055094		Click to Show/Hide the Full List
mod site	chr21:31668836-31668837:+		[4]
Sequence	AAATCACAGATGGGTATTAAACTTGTCAGAATTTCTTTGTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000270142.10; ENST00000389995.4; ENST00000470944.1
External Link	RMBase: m6A_site_544844
mod ID: M6ASITE055095		Click to Show/Hide the Full List
mod site	chr21:31668877-31668878:+		[4]
Sequence	ATTCAAGCCTGTGAATAAAAACCCTGTATGGCACTTATTAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000389995.4; ENST00000470944.1; ENST00000270142.10
External Link	RMBase: m6A_site_544845
mod ID: M6ASITE055096		Click to Show/Hide the Full List
mod site	chr21:31668925-31668926:+		[4]
Sequence	TTAAAAGAATCCAAATTCAAACTAAATTAGCTCTGATACTT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000270142.10; ENST00000389995.4; ENST00000470944.1
External Link	RMBase: m6A_site_544846

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000292		Click to Show/Hide the Full List
mod site	chr21:31668553-31668554:+		[8]
Sequence	GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000389995.4; ENST00000270142.10; ENST00000470944.1
External Link	RMBase: Nm_site_4741

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000168		Click to Show/Hide the Full List
mod site	chr21:31666472-31666473:+		[9]
Sequence	TACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAAC
Transcript ID List	ENST00000470944.1; ENST00000476106.5; ENST00000270142.10; ENST00000389995.4
External Link	RMBase: Pseudo_site_3325

Ref 1	GEMSTONE-301: a phase III clinical trial of CS1001 as consolidation therapy in patients with locally advanced/unresectable (stage III) non-small cell lung cancer (NSCLC) who did not have disease progression after prior concurrent/sequential chemoradiotherapy. Transl Lung Cancer Res. 2020 Oct;9(5):2008-2015. doi: 10.21037/tlcr-20-608.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 8	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 9	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map