m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01423)

Target Name	Spindlin-2A (SPIN2A)
Synonyms	Protein DXF34; Spindlin-like protein 2A; SPIN-2 Click to Show/Hide
Gene Name	SPIN2A
Chromosomal Location	Xp11.21
Family	SPIN/STSY family
Function	May be involved in the regulation of cell cycle progression (By similarity). Exhibits H3K4me3-binding activity (PubMed:29061846). Click to Show/Hide
Gene ID	54466
Uniprot ID	SPI2A_HUMAN
HGNC ID	HGNC:20694
KEGG ID	hsa:54466

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01423)

Spindlin-2A (SPIN2A)

N6-methyladenosine (m6A)

In total 4 m6A sequence/site(s) in this target gene
mod ID: M6ASITE091894		Click to Show/Hide the Full List
mod site	chrX:57135107-57135108:-		[2]
Sequence	GAGGAATTCAAAGAAGAAAGACTGACAGAGGGAGTGAGAAT
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000374908.1
External Link	RMBase: m6A_site_861698
mod ID: M6ASITE091895		Click to Show/Hide the Full List
mod site	chrX:57135468-57135469:-		[2]
Sequence	TGGAGGGGGCAGGGGAAGGAACAAGAGATTGGCTGTCTTGG
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000374908.1
External Link	RMBase: m6A_site_861699
mod ID: M6ASITE091897		Click to Show/Hide the Full List
mod site	chrX:57135799-57135800:-		[3]
Sequence	CTGTTAGGGTAAAATTTGGCACATGTGTGGAAACAAATGTA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000374906.3; ENST00000614076.1; ENST00000374908.1
External Link	RMBase: m6A_site_861700
mod ID: M6ASITE091898		Click to Show/Hide the Full List
mod site	chrX:57136520-57136521:-		[3]
Sequence	ACGGGCCACTGGGTCTGCAAACATGACAAAGAAAAAAGTCT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000374906.3; ENST00000614076.1; ENST00000374908.1
External Link	RMBase: m6A_site_861701

Ref 1	Elimination of arthritis pain and inflammation for over 2 years with a single 90 min, topical 14% gallium nitrate treatment: case reports and review of actions of gallium III. Med Hypotheses. 2005;65(6):1136-41. doi: 10.1016/j.mehy.2005.06.021. Epub 2005 Aug 24.
Ref 2	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 3	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.