m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01364)

Target Name	Malignant T-cell-amplified sequence 1 (MCT1)
Synonyms	MCT-1; Multiple copies T-cell malignancies Click to Show/Hide
Gene Name	MCT1
Chromosomal Location	Xq24
Family	MCTS1 family
Function	Anti-oncogene that plays a role in cell cycle regulation; decreases cell doubling time and anchorage-dependent growth; shortens the duration of G1 transit time and G1/S transition. When constitutively expressed, increases CDK4 and CDK6 kinases activity and CCND1/cyclin D1 protein level, as well as G1 cyclin/CDK complex formation. Involved in translation initiation; promotes recruitment of aminoacetyled initiator tRNA to P site of 40S ribosomes. Can promote release of deacylated tRNA and mRNA from recycled 40S subunits following ABCE1-mediated dissociation of post-termination ribosomal complexes into subunits. Plays a role as translation enhancer; recruits the density-regulated protein/DENR and binds to the cap complex of the 5'-terminus of mRNAs, subsequently altering the mRNA translation profile; up-regulates protein levels of BCL2L2, TFDP1, MRE11, CCND1 and E2F1, while mRNA levels remains constant. Hyperactivates DNA damage signaling pathway; increased gamma-irradiation-induced phosphorylation of histone H2AX, and induces damage foci formation. Increases the overall number of chromosomal abnormalities such as larger chromosomes formation and multiple chromosomal fusions when overexpressed in gamma-irradiated cells. May play a role in promoting lymphoid tumor development: lymphoid cell lines overexpressing MCTS1 exhibit increased growth rates and display increased protection against apoptosis. May contribute to the pathogenesis and progression of breast cancer via promotion of angiogenesis through the decline of inhibitory THBS1/thrombospondin-1, and inhibition of apoptosis. Involved in the process of proteasome degradation to down-regulate Tumor suppressor p53/TP53 in breast cancer cell; Positively regulates phosphorylation of MAPK1 and MAPK3. Involved in translation initiation; promotes aminoacetyled initiator tRNA to P site of 40S ribosomes. Can promote release of deacylated tRNA and mRNA from recycled 40S subunits following ABCE1-mediated dissociation of post-termination ribosomal complexes into subunits. Click to Show/Hide
Gene ID	28985
Uniprot ID	MCTS1_HUMAN
HGNC ID	HGNC:23357
KEGG ID	hsa:28985

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01364)

Malignant T-cell-amplified sequence 1 (MCT1)

Adenosine-to-Inosine editing (A-to-I)

In total 5 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003847		Click to Show/Hide the Full List
mod site	chrX:120608968-120608969:+		[2]
Sequence	GAGTCCCAGATGGTCCTTAAAGATCGATTCAACTCATGACA
Transcript ID List	ENST00000493274.5; ENST00000371315.3; ENST00000487133.1; ENST00000371317.10
External Link	RMBase: RNA-editing_site_142952
mod ID: A2ISITE003848		Click to Show/Hide the Full List
mod site	chrX:120609050-120609051:+		[2]
Sequence	TTTCAGCTATTTTCTGGATTAAATAGATTTTTGTGACTATT
Transcript ID List	ENST00000487133.1; ENST00000493274.5; ENST00000371315.3; ENST00000371317.10
External Link	RMBase: RNA-editing_site_142953
mod ID: A2ISITE003849		Click to Show/Hide the Full List
mod site	chrX:120610302-120610303:+		[2]
Sequence	CTGCACTCCAGCCGGGTGACAAAGCAAGACTCCATCTCAAA
Transcript ID List	ENST00000371317.10; rmsk_3111130; ENST00000487133.1; ENST00000371315.3; ENST00000493274.5
External Link	RMBase: RNA-editing_site_142954
mod ID: A2ISITE003850		Click to Show/Hide the Full List
mod site	chrX:120611519-120611520:+		[2]
Sequence	ACCTCTGCCTCCCAGGTTCAAGCGATTCTTGTGCCTCAGCC
Transcript ID List	ENST00000371317.10; ENST00000487133.1; ENST00000484481.1; ENST00000371315.3
External Link	RMBase: RNA-editing_site_142955
mod ID: A2ISITE003851		Click to Show/Hide the Full List
mod site	chrX:120617898-120617899:+		[2]
Sequence	AAAAAGTGCTATTTTTCCAAACGTATGCCTTGAAAACAAAT
Transcript ID List	ENST00000371317.10
External Link	RMBase: RNA-editing_site_142956

N6-methyladenosine (m6A)

In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE093273		Click to Show/Hide the Full List
mod site	chrX:120604168-120604169:+		[3]
Sequence	CGTGTGAGGGGATCTGCCGGACCCCTGCAAATTCAATTTCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549; fibroblasts; iSLK; MSC
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000493274.5; ENST00000371317.10; ENST00000493879.5
External Link	RMBase: m6A_site_871590
mod ID: M6ASITE093274		Click to Show/Hide the Full List
mod site	chrX:120605449-120605450:+		[4]
Sequence	CCAACTGCATCCAGTTGAAAACTTCAGTTATTAAGGGTATT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000371315.3; ENST00000487133.1; ENST00000371317.10; ENST00000493879.5; ENST00000493274.5
External Link	RMBase: m6A_site_871591
mod ID: M6ASITE093275		Click to Show/Hide the Full List
mod site	chrX:120605505-120605506:+		[4]
Sequence	GAGCAATTTCCAGGTATTGAACCATGGCTTAATCAAATCAT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000371315.3; ENST00000371317.10; ENST00000487133.1; ENST00000493879.5; ENST00000493274.5
External Link	RMBase: m6A_site_871592
mod ID: M6ASITE093276		Click to Show/Hide the Full List
mod site	chrX:120606084-120606085:+		[4]
Sequence	CATTTGTCTTACAGCCATGAACATATAGAAATCCTTACAGT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000371315.3; ENST00000493879.5; ENST00000487133.1; ENST00000371317.10; ENST00000493274.5
External Link	RMBase: m6A_site_871593
mod ID: M6ASITE093277		Click to Show/Hide the Full List
mod site	chrX:120606100-120606101:+		[5]
Sequence	ATGAACATATAGAAATCCTTACAGTAAATGGAGAATTACTC
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000493274.5; ENST00000487133.1; ENST00000371315.3; ENST00000371317.10; ENST00000493879.5
External Link	RMBase: m6A_site_871594
mod ID: M6ASITE093278		Click to Show/Hide the Full List
mod site	chrX:120606129-120606130:+		[4]
Sequence	GGAGAATTACTCTTTTTTAGACAAAGAGAAGGGCCTTTTTA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000371317.10; ENST00000371315.3; ENST00000493274.5; ENST00000493879.5; ENST00000487133.1
External Link	RMBase: m6A_site_871595
mod ID: M6ASITE093279		Click to Show/Hide the Full List
mod site	chrX:120606170-120606171:+		[6]
Sequence	TCCAACCCTAAGATTACTTCACAAATGTAAGGTTTTTTTAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371315.3; ENST00000493274.5; ENST00000371317.10; ENST00000487133.1
External Link	RMBase: m6A_site_871596
mod ID: M6ASITE093280		Click to Show/Hide the Full List
mod site	chrX:120608240-120608241:+		[6]
Sequence	ACAGATCCTTTTATCCTGCCACACCAGCAGGTTGATAAAGG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371315.3; ENST00000487133.1; ENST00000493274.5; ENST00000371317.10
External Link	RMBase: m6A_site_871597
mod ID: M6ASITE093281		Click to Show/Hide the Full List
mod site	chrX:120608276-120608277:+		[5]
Sequence	AAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCAT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000493274.5; ENST00000371317.10; ENST00000487133.1; ENST00000371315.3
External Link	RMBase: m6A_site_871598
mod ID: M6ASITE093282		Click to Show/Hide the Full List
mod site	chrX:120611074-120611075:+		[6]
Sequence	CATGAAGATGTCTGCAGAAGACATGTAAGTCTTACTTTAGG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000487133.1; ENST00000371315.3; ENST00000484481.1; ENST00000371317.10
External Link	RMBase: m6A_site_871599
mod ID: M6ASITE093283		Click to Show/Hide the Full List
mod site	chrX:120612193-120612194:+		[6]
Sequence	CTTCTACAGTGAGAAAGTCAACAAAGGAATTGGCATTGAAA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371315.3; ENST00000371317.10; ENST00000484481.1; ENST00000487133.1
External Link	RMBase: m6A_site_871600
mod ID: M6ASITE093284		Click to Show/Hide the Full List
mod site	chrX:120612252-120612253:+		[4]
Sequence	ATGGGCTGTGGCATATGAAGACATATAAATGAGCCTCAGAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000487133.1; ENST00000484481.1; ENST00000371317.10; ENST00000371315.3
External Link	RMBase: m6A_site_871601
mod ID: M6ASITE093285		Click to Show/Hide the Full List
mod site	chrX:120612280-120612281:+		[5]
Sequence	ATGAGCCTCAGAAGGAATGCACTTGGGCTAAATATGGATAT
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000371315.3; ENST00000487133.1; ENST00000371317.10; ENST00000484481.1
External Link	RMBase: m6A_site_871602
mod ID: M6ASITE093286		Click to Show/Hide the Full List
mod site	chrX:120612424-120612425:+		[4]
Sequence	ATTATTTTAAGTTTTCTTAAACTCAAGTTAAAATTGGGTAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000371317.10
External Link	RMBase: m6A_site_871603
mod ID: M6ASITE093287		Click to Show/Hide the Full List
mod site	chrX:120615355-120615356:+		[6]
Sequence	TTGGACTCACTTTTACTCAGACAAGGTCAGTTCAGCTCAAT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371317.10
External Link	RMBase: m6A_site_871604
mod ID: M6ASITE093288		Click to Show/Hide the Full List
mod site	chrX:120615600-120615601:+		[7]
Sequence	AAATTGTAAATTACAAATGAACTAAATGTAGTAATATTCCA
Motif Score	3.373380952
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000371317.10
External Link	RMBase: m6A_site_871605
mod ID: M6ASITE093289		Click to Show/Hide the Full List
mod site	chrX:120615752-120615753:+		[8]
Sequence	GATCAGTTCTCTTCTAGCAGACTGTCTGTTATGGTGGTTTG
Motif Score	3.319380952
Cell/Tissue List	HEK293T; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000371317.10
External Link	RMBase: m6A_site_871606
mod ID: M6ASITE093290		Click to Show/Hide the Full List
mod site	chrX:120618812-120618813:+		[6]
Sequence	AAGTGTCTGAAAAGGAGTCCACAAAGTATTTCTGCTTTCTT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371317.10
External Link	RMBase: m6A_site_871607
mod ID: M6ASITE093291		Click to Show/Hide the Full List
mod site	chrX:120618863-120618864:+		[6]
Sequence	GCAAAGGTCTGAGAGAAGGCACATCCTCATTAGCTTCTGGG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000371317.10
External Link	RMBase: m6A_site_871608
mod ID: M6ASITE093292		Click to Show/Hide the Full List
mod site	chrX:120620284-120620285:+		[8]
Sequence	ACCACTGCATTCCAGCCTGGACAACAGAGCGAAACTCCGTC
Motif Score	3.643047619
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_3111147; ENST00000371317.10
External Link	RMBase: m6A_site_871609
mod ID: M6ASITE093293		Click to Show/Hide the Full List
mod site	chrX:120620297-120620298:+		[8]
Sequence	AGCCTGGACAACAGAGCGAAACTCCGTCTCAAAAACCAACC
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_3111147; ENST00000371317.10
External Link	RMBase: m6A_site_871610
mod ID: M6ASITE093294		Click to Show/Hide the Full List
mod site	chrX:120620311-120620312:+		[8]
Sequence	AGCGAAACTCCGTCTCAAAAACCAACCAAACAAAAAACAAA
Motif Score	2.185083333
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000371317.10; rmsk_3111147
External Link	RMBase: m6A_site_871611
mod ID: M6ASITE093295		Click to Show/Hide the Full List
mod site	chrX:120620320-120620321:+		[8]
Sequence	CCGTCTCAAAAACCAACCAAACAAAAAACAAAAATTAGCTG
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_3111147; ENST00000371317.10
External Link	RMBase: m6A_site_871612
mod ID: M6ASITE093296		Click to Show/Hide the Full List
mod site	chrX:120620327-120620328:+		[8]
Sequence	AAAAACCAACCAAACAAAAAACAAAAATTAGCTGGGCATGG
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000371317.10; rmsk_3111147
External Link	RMBase: m6A_site_871613
mod ID: M6ASITE093297		Click to Show/Hide the Full List
mod site	chrX:120621054-120621055:+		[9]
Sequence	ATACACCCTGGATTTCAAAGACTTAATAAATAATGTAAATT
Motif Score	3.319380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_3111149; ENST00000371317.10
External Link	RMBase: m6A_site_871614

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000285		Click to Show/Hide the Full List
mod site	chrX:120605468-120605469:+		[10]
Sequence	AACTTCAGTTATTAAGGGTATTAAGAATCAATTGATAGAGC
Transcript ID List	ENST00000493274.5; ENST00000371315.3; ENST00000493879.5; ENST00000371317.10; ENST00000487133.1
External Link	RMBase: Pseudo_site_4976

Ref 1	Glutamine 161 of Glut1 glucose transporter is critical for transport activity and exofacial ligand binding. J Biol Chem. 1994 Aug 12;269(32):20533-8.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 8	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 9	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 10	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map