m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01347)
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01347)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE061388 | Click to Show/Hide the Full List | ||
| mod site | chr3:52781987-52781988:+ | [2] | |
| Sequence | GCCAGCAGCAGTCCTGCCCCACATGCTCTACATCCTTACTG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000537050.5; ENST00000273283.7; ENST00000487686.5; ENST00000494603.1; ENST00000478667.5; ENST00000628722.2 | ||
| External Link | RMBase: m6A_site_594316 | ||
| mod ID: M6ASITE061389 | Click to Show/Hide the Full List | ||
| mod site | chr3:52787084-52787085:+ | [2] | |
| Sequence | CGGCCTGAAGCCCACCATCGACAAGCCCTCAGAGGGTATAG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000628722.2; ENST00000273283.7; ENST00000428133.5; ENST00000484844.2; ENST00000537050.5 | ||
| External Link | RMBase: m6A_site_594317 | ||
References