m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00940)

Target Name	Pituitary homeobox 3 (PTX3)
Synonyms	Homeobox protein PITX3; Paired-like homeodomain transcription factor 3 Click to Show/Hide
Gene Name	PTX3
Chromosomal Location	10q24.32
Family	Paired homeobox family, Bicoid subfamily
Function	Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. In addition to its importance during development, it also has roles in the long-term survival and maintenance of the mdDA neurons. Activates NR4A2/NURR1-mediated transcription of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons. Acts by decreasing the interaction of NR4A2/NURR1 with the corepressor NCOR2/SMRT which acts through histone deacetylases (HDACs) to keep promoters of NR4A2/NURR1 target genes in a repressed deacetylated state. Essential for the normal lens development and differentiation. Plays a critical role in the maintenance of mitotic activity of lens epithelial cells, fiber cell differentiation and in the control of the temporal and spatial activation of fiber cell-specific crystallins. Positively regulates FOXE3 expression and negatively regulates PROX1 in the anterior lens epithelium, preventing activation of CDKN1B/P27Kip1 and CDKN1C/P57Kip2 and thus maintains lens epithelial cells in cell cycle (By similarity). Click to Show/Hide
Gene ID	5309
Uniprot ID	PITX3_HUMAN
HGNC ID	HGNC:9006
KEGG ID	hsa:5309

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00940)

Pituitary homeobox 3 (PTX3)

N6-methyladenosine (m6A)

In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE062766		Click to Show/Hide the Full List
mod site	chr3:157436871-157436872:+		[2]
Sequence	TCTCACTCTCCTCCGCTCAAACTCAGCTCACTTGAGAGTCT
Motif Score	2.627720238
Cell/Tissue List	iSLK; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_1142919; ENST00000295927.4
External Link	RMBase: m6A_site_616099
mod ID: M6ASITE062767		Click to Show/Hide the Full List
mod site	chr3:157436914-157436915:+		[3]
Sequence	TCCCGCCAGCTGTGGAAAGAACTTTGCGTCTCTCCAGCAAT
Motif Score	3.373380952
Cell/Tissue List	Huh7; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616101
mod ID: M6ASITE062768		Click to Show/Hide the Full List
mod site	chr3:157436988-157436989:+		[3]
Sequence	GTCTGCAGTGTTGGCCGAGAACTCGGATGATTATGATCTCA
Motif Score	3.373380952
Cell/Tissue List	Huh7; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616102
mod ID: M6ASITE062769		Click to Show/Hide the Full List
mod site	chr3:157437024-157437025:+		[3]
Sequence	TCTCATGTATGTGAATTTGGACAACGAAATAGACAATGGAC
Motif Score	3.643047619
Cell/Tissue List	Huh7; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616103
mod ID: M6ASITE062770		Click to Show/Hide the Full List
mod site	chr3:157437036-157437037:+		[3]
Sequence	GAATTTGGACAACGAAATAGACAATGGACTCCATCCCACTG
Motif Score	2.897386905
Cell/Tissue List	Huh7; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616104
mod ID: M6ASITE062771		Click to Show/Hide the Full List
mod site	chr3:157437043-157437044:+		[3]
Sequence	GACAACGAAATAGACAATGGACTCCATCCCACTGAGGACCG
Motif Score	4.065041667
Cell/Tissue List	Huh7; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616105
mod ID: M6ASITE062772		Click to Show/Hide the Full List
mod site	chr3:157437060-157437061:+		[3]
Sequence	TGGACTCCATCCCACTGAGGACCGTAAGTTCACTTTAACTG
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616106
mod ID: M6ASITE062773		Click to Show/Hide the Full List
mod site	chr3:157437575-157437576:+		[4]
Sequence	GCTCTTCATCATGCTGGAGAACTCGCAGATGAGAGAGCGCA
Motif Score	3.373380952
Cell/Tissue List	NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616107
mod ID: M6ASITE062774		Click to Show/Hide the Full List
mod site	chr3:157442593-157442594:+		[5]
Sequence	TGTGGTGGGTGGAGAGGAGAACAAACTGGTTGCTGAAGCCA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; GSCs; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616108
mod ID: M6ASITE062775		Click to Show/Hide the Full List
mod site	chr3:157442634-157442635:+		[5]
Sequence	TGGTTTCCCTGGGAAGGTGGACCCACCTGTGCGGCACCTGG
Motif Score	3.622404762
Cell/Tissue List	HEK293T; H1A; H1B; hESCs; fibroblasts; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; GSCs; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616109
mod ID: M6ASITE062776		Click to Show/Hide the Full List
mod site	chr3:157442696-157442697:+		[6]
Sequence	TCCTTGTGGGTAAATGGTGAACTGGCGGCTACCACTGTTGA
Motif Score	3.373380952
Cell/Tissue List	CD34; HEK293T; H1B; hESCs; fibroblasts; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616110
mod ID: M6ASITE062777		Click to Show/Hide the Full List
mod site	chr3:157442808-157442809:+		[6]
Sequence	TGGGTGGTGGCTTTGATGAAACATTAGCCTTCTCTGGGAGA
Motif Score	2.20572619
Cell/Tissue List	CD34; HEK293T; hNPCs; fibroblasts; Huh7; peripheral-blood; GSC-11; iSLK; MSC; TIME; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616111
mod ID: M6ASITE062778		Click to Show/Hide the Full List
mod site	chr3:157442828-157442829:+		[6]
Sequence	ACATTAGCCTTCTCTGGGAGACTCACAGGCTTCAATATCTG
Motif Score	3.319380952
Cell/Tissue List	CD34; HEK293T; hNPCs; fibroblasts; Huh7; peripheral-blood; GSC-11; iSLK; MSC; TIME; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616112
mod ID: M6ASITE062779		Click to Show/Hide the Full List
mod site	chr3:157442883-157442884:+		[6]
Sequence	GCAATGAAGAGATAAGAGAGACCGGAGGAGCAGAGTCTTGT
Motif Score	2.876744048
Cell/Tissue List	CD34; HEK293T; hNPCs; fibroblasts; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616113
mod ID: M6ASITE062780		Click to Show/Hide the Full List
mod site	chr3:157442989-157442990:+		[5]
Sequence	TGTTTCATAAATGTTGTGAAACTCCACTTGAAGCCAAAGAA
Motif Score	2.627720238
Cell/Tissue List	HEK293T; hNPCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616114
mod ID: M6ASITE062781		Click to Show/Hide the Full List
mod site	chr3:157443014-157443015:+		[5]
Sequence	ACTTGAAGCCAAAGAAAGAAACTCACACTTAAAACACATGC
Motif Score	2.627720238
Cell/Tissue List	HEK293T; hNPCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616115
mod ID: M6ASITE062782		Click to Show/Hide the Full List
mod site	chr3:157443027-157443028:+		[5]
Sequence	GAAAGAAACTCACACTTAAAACACATGCCAGTTGGGAAGGT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hNPCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616116
mod ID: M6ASITE062783		Click to Show/Hide the Full List
mod site	chr3:157443054-157443055:+		[5]
Sequence	CCAGTTGGGAAGGTCTGAAAACTCAGTGCATAATAGGAACA
Motif Score	2.627720238
Cell/Tissue List	HEK293T; hNPCs; hESCs; fibroblasts; A549; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616117
mod ID: M6ASITE062784		Click to Show/Hide the Full List
mod site	chr3:157443072-157443073:+		[5]
Sequence	AAACTCAGTGCATAATAGGAACACTTGAGACTAATGAAAGA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616118
mod ID: M6ASITE062785		Click to Show/Hide the Full List
mod site	chr3:157443081-157443082:+		[5]
Sequence	GCATAATAGGAACACTTGAGACTAATGAAAGAGAGAGTTGA
Motif Score	3.319380952
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616119
mod ID: M6ASITE062786		Click to Show/Hide the Full List
mod site	chr3:157443103-157443104:+		[5]
Sequence	TAATGAAAGAGAGAGTTGAGACCAATCTTTATTTGTACTGG
Motif Score	2.876744048
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616120
mod ID: M6ASITE062787		Click to Show/Hide the Full List
mod site	chr3:157443139-157443140:+		[5]
Sequence	ACTGGCCAAATACTGAATAAACAGTTGAAGGAAAGACATTG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616121
mod ID: M6ASITE062788		Click to Show/Hide the Full List
mod site	chr3:157443154-157443155:+		[7]
Sequence	AATAAACAGTTGAAGGAAAGACATTGGAAAAAGCTTTTGAG
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hESC-HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616122
mod ID: M6ASITE062789		Click to Show/Hide the Full List
mod site	chr3:157443189-157443190:+		[5]
Sequence	TTTGAGGATAATGTTACTAGACTTTATGCCATGGTGCTTTC
Motif Score	3.319380952
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616123
mod ID: M6ASITE062790		Click to Show/Hide the Full List
mod site	chr3:157443238-157443239:+		[5]
Sequence	GCTGTGTCTCTGTCAGATAAACTCTCAAATAATTAAAAAGG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; U2OS; hNPCs; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616124
mod ID: M6ASITE062791		Click to Show/Hide the Full List
mod site	chr3:157443259-157443260:+		[5]
Sequence	CTCTCAAATAATTAAAAAGGACTGTATTGTTGAACAGAGGG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616125
mod ID: M6ASITE062792		Click to Show/Hide the Full List
mod site	chr3:157443272-157443273:+		[5]
Sequence	AAAAAGGACTGTATTGTTGAACAGAGGGACAATTGTTTTAC
Motif Score	2.951386905
Cell/Tissue List	HEK293T; fibroblasts; Huh7; iSLK; MSC; TIME; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616126
mod ID: M6ASITE062793		Click to Show/Hide the Full List
mod site	chr3:157443280-157443281:+		[5]
Sequence	CTGTATTGTTGAACAGAGGGACAATTGTTTTACTTTTCTTT
Motif Score	3.643047619
Cell/Tissue List	HEK293T; fibroblasts; Huh7; iSLK; MSC; TIME; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000295927.4
External Link	RMBase: m6A_site_616127

Ref 1	US patent application no. 7,427,470, Antisense modulation of helicase-moi expression.
Ref 2	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 3	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 4	METTL14 Inhibits Hematopoietic Stem/Progenitor Differentiation and Promotes Leukemogenesis via mRNA m(6)A Modification. Cell Stem Cell. 2018 Feb 1;22(2):191-205.e9. doi: 10.1016/j.stem.2017.11.016. Epub 2017 Dec 28.
Ref 5	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 6	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map